ID: 1002399765

View in Genome Browser
Species Human (GRCh38)
Location 5:178985118-178985140
Sequence CAGTGTGGATGAGAGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002399765_1002399770 -9 Left 1002399765 5:178985118-178985140 CCCTGTGCCTCTCATCCACACTG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1002399770 5:178985132-178985154 TCCACACTGCCCCAGGGAGCAGG 0: 1
1: 0
2: 3
3: 38
4: 292
1002399765_1002399772 -8 Left 1002399765 5:178985118-178985140 CCCTGTGCCTCTCATCCACACTG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1002399772 5:178985133-178985155 CCACACTGCCCCAGGGAGCAGGG 0: 1
1: 0
2: 3
3: 35
4: 381
1002399765_1002399780 27 Left 1002399765 5:178985118-178985140 CCCTGTGCCTCTCATCCACACTG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1002399780 5:178985168-178985190 CCTTGTGGAAACAGGAAAACCGG No data
1002399765_1002399776 12 Left 1002399765 5:178985118-178985140 CCCTGTGCCTCTCATCCACACTG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1002399776 5:178985153-178985175 GGGCAGCAGAGACTCCCTTGTGG 0: 1
1: 0
2: 1
3: 23
4: 302
1002399765_1002399777 19 Left 1002399765 5:178985118-178985140 CCCTGTGCCTCTCATCCACACTG 0: 1
1: 0
2: 1
3: 27
4: 297
Right 1002399777 5:178985160-178985182 AGAGACTCCCTTGTGGAAACAGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002399765 Original CRISPR CAGTGTGGATGAGAGGCACA GGG (reversed) Intronic
902186145 1:14726841-14726863 GAGCGTGCATGAGAGGCACCTGG - Intronic
904393041 1:30198247-30198269 CAGAGGGGATGAGAGAGACAGGG + Intergenic
908984878 1:70005854-70005876 CAGTGTGCATGCCAGTCACAAGG - Intronic
910205291 1:84743395-84743417 AAGTGAGGATGAGAGTCCCAGGG - Intergenic
910263926 1:85318215-85318237 CCGTTTTGAGGAGAGGCACAGGG + Intergenic
910492589 1:87788922-87788944 CATTATGGATGATAGGTACATGG - Intergenic
910860940 1:91741856-91741878 CAGTGTGGAGGAGGGGTAGAAGG - Intronic
912149246 1:106836932-106836954 TAGTGAGGATGAGAAGCATAAGG + Intergenic
912704573 1:111902399-111902421 GAGTGCGGATGAGGGACACAGGG + Intronic
913167604 1:116203044-116203066 CAGTGTGGATGAGAGGTGTATGG - Intergenic
914334038 1:146699093-146699115 CTGTGTGAAAGAGAAGCACAAGG + Intergenic
916008724 1:160685230-160685252 CAGTGTTGCTGACAGGCCCAGGG + Intronic
921087971 1:211814323-211814345 CAGTGTGGAAGGGTGTCACAAGG + Intronic
921741285 1:218687873-218687895 CAGTGAGGATCAGAGGCAATTGG + Intergenic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
924148452 1:241101793-241101815 CAGGCTGGATTAGAGGGACATGG + Intronic
1063696111 10:8336654-8336676 CAATGGGGAGGGGAGGCACAAGG + Intergenic
1064445239 10:15387167-15387189 GGTTGTGGAGGAGAGGCACAAGG - Intergenic
1064633770 10:17343174-17343196 CAATGTAGATGAGAAGCAGAAGG + Intronic
1064980265 10:21159635-21159657 CAATCTGGACAAGAGGCACATGG + Intronic
1065788144 10:29235477-29235499 GAGTGTGGATAGGAGGCAGAAGG + Intergenic
1065954721 10:30683696-30683718 CAGTGAGGAGGAGAGGCATCAGG + Intergenic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1067314716 10:45150965-45150987 AAGTTCTGATGAGAGGCACAGGG + Intergenic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1068669820 10:59711088-59711110 CAGTGAGAATGAGAGCAACATGG + Intronic
1068778906 10:60898480-60898502 CAGTGTGTATGAGATGCAGAGGG + Intronic
1068823863 10:61410934-61410956 CTATGTGGATGCGAGTCACAGGG - Intronic
1068943547 10:62705262-62705284 CATTGTGCATGAGAGTCACCTGG - Intergenic
1070023769 10:72611661-72611683 CAGTTTTGACGAGAGGTACATGG + Intronic
1070824934 10:79385564-79385586 CAGAGTGGGTGGGAGGCAGAGGG + Exonic
1071069035 10:81670091-81670113 GTGTGTGGATGAGAGAAACACGG - Intergenic
1071823763 10:89303937-89303959 GAGTGTGACTGAGATGCACATGG + Intronic
1072009323 10:91289828-91289850 CAGTGTGGAAGACAGACACTTGG + Intergenic
1072781079 10:98252389-98252411 CAAGGTGGCTGAGGGGCACAAGG - Exonic
1072896646 10:99373029-99373051 CAGTGTAGATGACACCCACAAGG - Intronic
1073516428 10:104079520-104079542 CAGTGTGAATGAGAGTCATGTGG - Intronic
1074850480 10:117435521-117435543 CAAGGTGGATGATAGGAACATGG - Intergenic
1075055494 10:119215430-119215452 CAGTGTGGAGGAGGGGGAGAAGG + Intronic
1075162712 10:120038748-120038770 CAGTGAAGATGAGTGACACATGG + Intergenic
1075550048 10:123385687-123385709 CCGGGAGGATGAGAGGCACATGG - Intergenic
1076280516 10:129242510-129242532 CTGTGTGGGTGAGAAGCCCACGG - Intergenic
1076569859 10:131425596-131425618 GAGAGTGGGTGAGGGGCACAAGG + Intergenic
1077328135 11:1972437-1972459 CAGTGTGCAGGAGGGGAACATGG - Intronic
1078367089 11:10715745-10715767 CAGTGTGGAGGAGGGGGATACGG - Intergenic
1078565188 11:12408495-12408517 GGGTCTGGCTGAGAGGCACAGGG - Intronic
1079033432 11:17002432-17002454 GAGTGATGATGAGAGCCACAAGG + Intronic
1080927994 11:36778131-36778153 CATTGTAGATGAGAGGAAAATGG - Intergenic
1081264466 11:41002770-41002792 CAGTGTGTATGACAGCCACATGG + Intronic
1083176298 11:60952074-60952096 CAGTGGGGGTGAGGGGGACAGGG - Intronic
1083292054 11:61695908-61695930 GAGTGTGGATGACAGGCTCCGGG + Intronic
1083620335 11:64046220-64046242 CACTTTGGATGAGAGGGACTGGG - Intronic
1084436456 11:69144332-69144354 CGGGGTGGATGGGGGGCACAGGG + Intergenic
1084624997 11:70299680-70299702 AAGCTTGGATGAGAGGCAGAGGG - Intronic
1085044366 11:73344544-73344566 GAGTGTGGCTGAGGGGCCCAGGG + Intronic
1085265007 11:75232057-75232079 CATTGTAGATGAGAGGGGCACGG + Intergenic
1087595341 11:100247043-100247065 CTGTATGAATGAGAGGGACATGG + Intronic
1088828890 11:113518382-113518404 CAGTGCAGATGTGAGGAACAGGG - Intergenic
1088994749 11:114986634-114986656 CAGTGCGGATGAGAAGGCCAAGG - Intergenic
1202811114 11_KI270721v1_random:27617-27639 CAGTGTGCAGGAGGGGAACATGG - Intergenic
1091838326 12:3601657-3601679 CCGTGTGGATGAGAGCCACGCGG - Intergenic
1092262201 12:6958758-6958780 CTGGGTGGATGAGAGGCAGTGGG + Intronic
1093414965 12:18909249-18909271 CAGGGTGTCTGAGAGACACAGGG + Intergenic
1093560118 12:20528412-20528434 CACTTTGAATCAGAGGCACAAGG + Intronic
1097313226 12:58144049-58144071 CAGTGTGTATGAGAGACATTCGG - Intergenic
1099758987 12:86893729-86893751 CAATGGGGTTGAGAGCCACAGGG - Intergenic
1100278968 12:93099742-93099764 CAGTGTGGAAGAGACTGACATGG - Intergenic
1101584478 12:106072927-106072949 CAGAGTGGATGAAGGGCACCTGG + Intronic
1102166225 12:110808919-110808941 CAGGCTGGATTAGAGTCACATGG + Intergenic
1104381005 12:128307980-128308002 CCATGGGAATGAGAGGCACAGGG + Intronic
1104833876 12:131774111-131774133 CAGTGTGGCTGCGGGGCACGGGG + Intronic
1105216679 13:18290993-18291015 CAGTGTGGAGCAGAGGCTCTCGG + Intergenic
1105241286 13:18611082-18611104 GAGTTTGGATGAGAGGCAGTTGG + Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1106384024 13:29266998-29267020 CAGACTGAATGACAGGCACAGGG + Intronic
1106395840 13:29380134-29380156 CAGTGTGGAACAGAGGGACAAGG - Intronic
1106571894 13:30934863-30934885 CAGGGAGGCTCAGAGGCACAGGG - Intronic
1107833059 13:44391564-44391586 CAATGTAAAGGAGAGGCACATGG + Intronic
1110519927 13:76463695-76463717 CAGTGAGGCTGAGTGGCACATGG - Intergenic
1112101165 13:96190902-96190924 CAGTGGGGCTGAGTGACACAAGG + Intronic
1113868069 13:113541951-113541973 ATGTGTGGATGATACGCACACGG + Intronic
1113868074 13:113542008-113542030 ATGTGTGGATGATACGCACACGG + Intronic
1113868079 13:113542065-113542087 ATGTGTGGATGATACGCACACGG + Intronic
1113868084 13:113542122-113542144 ATGTGTGGATGATACGCACACGG + Intronic
1113868089 13:113542179-113542201 ATGTGTGGATGATACGCACACGG + Intronic
1113868094 13:113542236-113542258 ATGTGTGGATGATACGCACACGG + Intronic
1113868099 13:113542293-113542315 ATGTGTGGATGATACGCACACGG + Intronic
1113868104 13:113542350-113542372 ATGTGTGGATGATACGCACACGG + Intronic
1115571474 14:34670721-34670743 CAGTGTGTAGGAGAGCCACAAGG - Intergenic
1116476304 14:45344338-45344360 CAGTGTCTCTGAGAGTCACAGGG + Intergenic
1118207046 14:63732110-63732132 CATTGTTAATGAGAGGGACAAGG + Intergenic
1118762682 14:68890287-68890309 CTGTGGGGATGGGAGGTACAGGG + Intronic
1121096377 14:91220610-91220632 CCGTGTGGCTGGGAGGCAGATGG + Intronic
1121554295 14:94824586-94824608 CAGAGTGGATGAGGGGAGCAGGG + Intergenic
1122890366 14:104729408-104729430 CAGTGTGGAGGTGAGGAGCAAGG + Intronic
1123490071 15:20774065-20774087 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1123546572 15:21343152-21343174 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1126455355 15:48855595-48855617 AGGTTTGGATGAGAAGCACAGGG + Intronic
1126935947 15:53708003-53708025 CAGAGGGGATGAGAGCAACAGGG - Intronic
1128994903 15:72288978-72289000 CAGAGTGGGTGAGAAGCTCAGGG + Intronic
1129388611 15:75209258-75209280 CAGTGTGGGAGAGAGACCCAGGG - Intronic
1130303645 15:82698982-82699004 GAGTGAGGACGAGAGGCCCAGGG - Intronic
1130822111 15:87506835-87506857 CAGTCTGAATTAGAGGCAGAAGG - Intergenic
1132025879 15:98404068-98404090 CAGCTTGGGTGAGAGGCCCATGG - Intergenic
1132407636 15:101553731-101553753 GACTGTGGACGAGAGGCACAGGG - Intergenic
1202954902 15_KI270727v1_random:70367-70389 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1135505656 16:23033848-23033870 CAGTGGGTCTGAAAGGCACATGG - Intergenic
1136476962 16:30519536-30519558 CAGTGTGGCTAACAGGCAGAGGG + Intronic
1138572040 16:57880941-57880963 CAGGATGGATTAGAGCCACAAGG + Intergenic
1139999580 16:71012156-71012178 CTGTGTGAAAGAGAAGCACAAGG - Intronic
1140350071 16:74253722-74253744 CAGTGAGAATGAGAGCCACGTGG + Intergenic
1140912486 16:79466899-79466921 CAGTGTGGAAGAGGGGACCACGG + Intergenic
1141512435 16:84521281-84521303 CAATGTGGATGTGAGTCACCTGG - Intronic
1142258173 16:89025732-89025754 CTGGGAGGATGAGAGGCCCAAGG + Intergenic
1142495583 17:304907-304929 CAGAGTGCAAGAGAGGCACAGGG + Intronic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1144658161 17:17051289-17051311 GAGTGTGGCAGCGAGGCACAGGG + Intronic
1146925513 17:36742353-36742375 CGGTGTGGATGGGAGTCATAGGG + Intergenic
1147190541 17:38735610-38735632 GAGTGGGGAGGAGAGACACAGGG + Intronic
1147450365 17:40500461-40500483 CTGTGTGGTTGGGAGGCACGGGG + Intronic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147590030 17:41676768-41676790 CAGGATGGAGGAGACGCACAGGG - Intergenic
1147643271 17:42017972-42017994 CGGAGTGGATGAAAGGCGCAGGG - Intronic
1150266949 17:63838040-63838062 AAGCATGGCTGAGAGGCACAGGG + Intronic
1152179942 17:78813143-78813165 CACTGTGGTTGAAAGGCAAAGGG - Intronic
1153896576 18:9567481-9567503 CAGTTGGGATTACAGGCACATGG + Intronic
1154447672 18:14448819-14448841 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1155063710 18:22250970-22250992 CCATTTGGAGGAGAGGCACAAGG - Intergenic
1156527471 18:37780021-37780043 CAGAGTTTATGAGAAGCACACGG - Intergenic
1157423708 18:47567431-47567453 TGGTGGGGATGAGGGGCACAGGG - Intergenic
1157667352 18:49499088-49499110 CAGTGTGGAAGGCAGGCGCACGG - Intergenic
1157679231 18:49590802-49590824 CAGTGTGCACGAGAGGCCCCAGG - Exonic
1159715285 18:71813964-71813986 CAATGTGGTTCAGAGCCACAGGG + Intergenic
1160332249 18:78004915-78004937 CAGAGTGGGGGAGAGACACAGGG - Intergenic
1160532569 18:79574137-79574159 CAGTGTCCATGTGTGGCACAAGG - Intergenic
1160809668 19:1007964-1007986 CATTGAGGGTGAGAGGCACCTGG + Exonic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1162555199 19:11382177-11382199 CAGTGTGTATGTGTGACACAAGG + Intronic
1163032706 19:14554687-14554709 GTGTGGGGATGAGAGGTACAGGG - Intronic
1164379830 19:27723378-27723400 TAGTGTGGATGAGTGTCTCAGGG - Intergenic
1164863092 19:31578566-31578588 CAGTGAGCATGAGAGACTCATGG - Intergenic
1166549760 19:43657417-43657439 CAGTGTGGAGCAGAGTCTCAGGG - Intronic
1167171376 19:47834506-47834528 CAGTGTGGATCTGATGCACCAGG + Exonic
925175791 2:1782731-1782753 CAGAGAGGCTGAGAGGAACATGG + Intergenic
925226452 2:2187499-2187521 CAGTATTGATGAGCGGCAGAGGG + Intronic
925456668 2:4022075-4022097 CAGTGTAGGTGGGAGTCACAGGG + Intergenic
925818015 2:7772171-7772193 CAGTGTGGGTGGCAGGCAAAAGG - Intergenic
926938024 2:18105529-18105551 CAGTATGTATGAGAGTCACCTGG + Intronic
928375713 2:30771568-30771590 CAGTGAGGTTGAGAGGCAACAGG + Intronic
930111875 2:47685606-47685628 CAGCGTGAATGGGAGGCTCAAGG + Intergenic
930224868 2:48781806-48781828 GAGTGTGGATGAGAGGAGCATGG + Intergenic
931047259 2:58369253-58369275 AACTGTGGAAGAGGGGCACAAGG - Intergenic
932544514 2:72693856-72693878 GAGTAAGGATGAGTGGCACAAGG - Intronic
933160190 2:79015324-79015346 CAGAGTGGAGGAGAGGAAGATGG - Intergenic
933274379 2:80267815-80267837 CAGTGAGGATGAGAGTCTAAGGG + Intronic
933737054 2:85503695-85503717 CAGTGTGGATGCCAGGCCCTGGG - Intergenic
934297649 2:91755685-91755707 CAGTGTGGAGCAGAGGCTCTCGG - Intergenic
934552927 2:95273058-95273080 CAGGGTGGGTGAGAGGCTCAGGG - Intergenic
934611665 2:95742601-95742623 CAGTTTAGATGAGAGACTCAAGG - Intergenic
936545002 2:113384214-113384236 CAGTTTAGATGAGAGACTCAAGG - Intergenic
941642564 2:168004785-168004807 CAGTGTGTATGAGAATCACTTGG + Intronic
944858626 2:203792551-203792573 GAGTGAGCATGAGAGGCCCATGG + Intergenic
946239414 2:218344787-218344809 CACTGTGGGTGAGAGGAACCAGG - Exonic
946395787 2:219443032-219443054 AGGTCTGGATGGGAGGCACAGGG + Intronic
946433533 2:219638027-219638049 CTGTGGGGTTGAGAGGCACGTGG + Intronic
947687831 2:232105860-232105882 CCATGGGGATGATAGGCACAGGG - Intronic
948088165 2:235267712-235267734 CTGTTTTGATGAGAGACACAGGG - Intergenic
948118448 2:235511223-235511245 GAGTGTGGATCAGAGGCTGAGGG - Intronic
948735054 2:239998187-239998209 CAAAGTGGATGAGAGGCCAAAGG - Intronic
1168734259 20:116321-116343 CAATGTGGTTGAGGGCCACAGGG - Intergenic
1168859708 20:1037149-1037171 CTGTGAGGATGAGATGCAAAGGG + Intergenic
1169022513 20:2340391-2340413 CAGTGTTGATACGAGACACACGG - Intronic
1169029320 20:2395638-2395660 CAGTGGGCAAGAGAGGCCCAGGG + Intronic
1170021455 20:11840843-11840865 CAGTGTTGAGCAGAGGAACAGGG - Intergenic
1170391374 20:15878370-15878392 CAGTGTGCATGAGTGTCACCTGG + Intronic
1170423646 20:16217039-16217061 CTGTGTGGGGCAGAGGCACAAGG + Intergenic
1170813281 20:19691957-19691979 CAGTGTCTATGGGAGGCAGAGGG - Intronic
1170815074 20:19707002-19707024 CAAAGAGAATGAGAGGCACATGG - Intronic
1172074324 20:32282421-32282443 CCCTGTAGAGGAGAGGCACAAGG + Intronic
1172739939 20:37158427-37158449 CCCTGTGGTTGGGAGGCACATGG - Intronic
1172778745 20:37423311-37423333 CAGTGTGGCTGAGAGGCCCTGGG + Intergenic
1173362709 20:42359164-42359186 CAGTGTGCATGAGAATCACCTGG - Intronic
1173960223 20:47065270-47065292 CAGTGAGAATGAGAAGCACTGGG - Intronic
1174416398 20:50369969-50369991 CAATGTGGTGGAGAGGCACCGGG - Intergenic
1174893177 20:54420194-54420216 AAGTGTGGATGAGAGGCCATAGG + Intergenic
1175995813 20:62811933-62811955 CTGGCTGGATGAGAGCCACAAGG - Intronic
1176056069 20:63149972-63149994 AAGTGTGTAAGAGGGGCACAGGG + Intergenic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1178707940 21:34889878-34889900 CGGGGTGGATGAGAGGCCCCGGG - Intronic
1181031218 22:20149610-20149632 CAACGTGGCTGAGATGCACATGG - Exonic
1183495408 22:38140551-38140573 CAGTGTGGATGGGAGGGAAGGGG + Intronic
1184071887 22:42151853-42151875 CAATGTGGACAGGAGGCACAGGG + Intergenic
1184195210 22:42922969-42922991 CAGTGGGCATGAGAAGGACAGGG + Intronic
1184284813 22:43464582-43464604 TTGTGGGGATGAGAGGCAAAGGG + Intronic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
1185017414 22:48352814-48352836 CTCTGGGGATGGGAGGCACATGG - Intergenic
949894819 3:8761254-8761276 CAGGGAGGATGAGAGGGGCATGG + Intronic
951624221 3:24642532-24642554 CAATGTGCATGAGAGTCACCTGG + Intergenic
952163984 3:30725630-30725652 AAGTGAGGGAGAGAGGCACAAGG - Intergenic
952171885 3:30816127-30816149 CAGTATAGATGAGAGGCTAATGG + Intronic
952240838 3:31530359-31530381 CACTGTGGAGGACAGGCACATGG - Intergenic
953368223 3:42365469-42365491 CAAGGAGGATGAGATGCACATGG - Intergenic
953830185 3:46290471-46290493 CAGTGTGGGTGCTAGGCACAAGG - Intergenic
954301435 3:49702746-49702768 CAGTGAGGGTGAGTGGCACCGGG + Exonic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
954748455 3:52800322-52800344 AAATGGGGATGAAAGGCACATGG - Intronic
955325375 3:58006116-58006138 AAGTCTGTAAGAGAGGCACAGGG - Intergenic
956142981 3:66164402-66164424 CAGGATGGATGAAAGGCATAAGG + Intronic
956605674 3:71070756-71070778 CAGTGTCAATGGGAAGCACAAGG + Intronic
956765963 3:72484773-72484795 CACTGTGCCTGAGAGACACACGG - Intergenic
956927920 3:74009382-74009404 CAGGGAGGATGAGAGACACATGG - Intergenic
958530082 3:95317039-95317061 CAGTGTGGAAGAGAGAGAGAGGG + Intergenic
960185480 3:114632752-114632774 CAGAATGGAAGGGAGGCACATGG + Intronic
960275838 3:115728273-115728295 CAGTGTGGTTCAGAGGCAGGAGG - Intergenic
960949236 3:122988333-122988355 CAGTGTGGAGGTGAGGCAGAAGG + Intronic
961827724 3:129607406-129607428 GAGTGTGGAGGGGAGACACAGGG - Intergenic
962259785 3:133895267-133895289 CAGGGTAGAGGAGAGGGACAGGG - Intronic
963005503 3:140723200-140723222 CAGTGTGGAGGGGTGGAACATGG - Intergenic
965672261 3:171158973-171158995 CAGAGTGAATGAGAGGGAGAAGG + Intronic
966847959 3:184145103-184145125 CAGTCAGGATGGGAGGCACATGG - Exonic
968070504 3:195781529-195781551 AAGTGTCGGTGACAGGCACAGGG + Exonic
968522309 4:1039571-1039593 CAGTGTGCAGGAGAGGCTGAGGG - Intergenic
968925752 4:3547176-3547198 CAGTGGGGATGAGGGGGACTTGG - Intergenic
969101027 4:4768443-4768465 CAGTGTGGATCAGAGGACTAGGG + Intergenic
969156552 4:5216105-5216127 CAGTGTGCATGAGAATCACCTGG + Intronic
970143135 4:13004642-13004664 CAGTGTAGAGATGAGGCACAGGG - Intergenic
970742888 4:19258300-19258322 CTGTGTGGAGAAGGGGCACATGG + Intergenic
972798469 4:42446972-42446994 CAATATGGATGAGAGTCATAGGG + Intronic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
977324426 4:95556574-95556596 CAAGGTGGATAAGAGACACATGG + Intergenic
978692419 4:111529806-111529828 CAATGTGGTTGAGAGCCACAAGG + Intergenic
979005609 4:115292024-115292046 CAGTGTAAATTATAGGCACATGG - Intergenic
984107727 4:175571090-175571112 CTCTGGGGATGAAAGGCACAAGG + Intergenic
984213721 4:176881769-176881791 CAAAGTGGGTGAGAGGAACAGGG - Intergenic
986540269 5:8838212-8838234 CAGTCTGGATGTCAGGTACATGG - Intergenic
987403321 5:17500249-17500271 CAGTGTGTCTTAGAGACACAAGG + Intergenic
987413364 5:17636476-17636498 CAGTGTGTCTTAGAGACACAAGG + Intergenic
988733304 5:33995140-33995162 CAGTGTGGATGGGATGGACATGG - Intronic
994620512 5:102156021-102156043 CAGTGTGGAAGAGAACCCCAGGG - Intergenic
994662089 5:102666344-102666366 CAGTGTGGGTCAGAGCCAGATGG + Intergenic
995484999 5:112631219-112631241 TAGGGAGGATGAGAGACACATGG + Intergenic
997869121 5:137491320-137491342 CAGTGCTGTTGAGAGGCAGAGGG - Intronic
999388347 5:151171726-151171748 CTGGGTGGCAGAGAGGCACATGG + Intergenic
1000327691 5:160184695-160184717 CAGTGAGGGTGAGAGGCCTAAGG + Intergenic
1000623309 5:163509530-163509552 CAGTGTGGATCAGAATCACCTGG - Intronic
1001944248 5:175765595-175765617 CAGTGGGGCTAAGAGGCATAAGG + Intergenic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1005305394 6:24508752-24508774 CAGTGTGGATGTGGTGAACAGGG - Intronic
1005839252 6:29730681-29730703 CAGTGGGCATGAGAGGCAGCAGG - Intronic
1006102361 6:31693436-31693458 CAGTGGGCACGAGAGGCAAAGGG + Intronic
1006433144 6:34010521-34010543 CAGTGTGGAGTAGAGGCTAAGGG + Intergenic
1007134321 6:39506959-39506981 CCAAGTGGAAGAGAGGCACAGGG - Intronic
1007952971 6:45888502-45888524 GAGTTTGGAAGAGAAGCACATGG + Intergenic
1011549097 6:88513162-88513184 CTGGGAGGATGAGTGGCACATGG - Intergenic
1013961721 6:115908958-115908980 CAGTGGGGAGGAGGGGTACATGG - Intergenic
1014236306 6:118959263-118959285 AAGTGTGGATGAGAACAACAAGG - Intergenic
1014768180 6:125431491-125431513 CAGTGTGCATGTGTGCCACAGGG - Intergenic
1017710022 6:157159086-157159108 CAGTGTGGATTAGAGCCACAGGG - Intronic
1019159882 6:170062717-170062739 CAGTGTGGCTGATGTGCACAGGG - Intergenic
1022268488 7:28782949-28782971 CTGTGTGCATGAAAGACACAGGG + Intronic
1022660589 7:32362861-32362883 CAGTGTGGCTGGGTGGCACCTGG + Intergenic
1023557373 7:41437340-41437362 GAGAGAGGCTGAGAGGCACAGGG - Intergenic
1024062752 7:45710930-45710952 CAGAGTGAATGAGAGCCACCAGG - Intronic
1024525918 7:50349390-50349412 CAGTTTTGATGAGAAGCGCATGG + Intronic
1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG + Intronic
1027007429 7:74707276-74707298 CCGTGTGAATAAGGGGCACAGGG - Intronic
1028420604 7:90628493-90628515 CAGTGTGGATGTGAATCACCTGG + Intronic
1031125215 7:117765680-117765702 CAGGGTGGAGGAGAGGGAAATGG - Intronic
1032549062 7:132767351-132767373 TTGTGTGCATGAGAGGCATAGGG - Intergenic
1033042121 7:137928231-137928253 CAGCCTGGATGAGAGGCGCCGGG + Exonic
1034543792 7:151776810-151776832 GTGTGTGGATTAGGGGCACAGGG + Intronic
1036824726 8:11967159-11967181 CAGAGTGCATGAGAGGCAGTAGG - Intergenic
1037329736 8:17732510-17732532 CAGACTGGATGAGAGCCCCACGG - Intronic
1037396738 8:18451349-18451371 CACAGTTGTTGAGAGGCACAGGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1039387412 8:37148265-37148287 CTGGTTGGAGGAGAGGCACATGG + Intergenic
1039893347 8:41699127-41699149 GAGTGTGGATAAGAGGGAGAGGG + Intronic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041726602 8:61023733-61023755 CAGGGTGGGGGAGAGGCCCAGGG + Intergenic
1042307452 8:67346349-67346371 CAGTGTGGCTGAAAGGATCAAGG + Intergenic
1043349860 8:79347118-79347140 GAGGGAGGATGAGAGGCACATGG - Intergenic
1044684006 8:94809756-94809778 AAATGTGGCTGAGAGGCCCAAGG + Intergenic
1046118055 8:109808352-109808374 CAGTCTGAATGAGAGGAACAAGG + Intergenic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1047678632 8:127230711-127230733 CAATGTGTATGAGAGAGACAAGG + Intergenic
1048625736 8:136183017-136183039 CAGGATGGATGAAAGGCACGAGG + Intergenic
1048911058 8:139135532-139135554 CTGTGTGGGTGAGAGGCCAAAGG + Intergenic
1049039926 8:140104927-140104949 CAGCATGGATGACAGGCCCAGGG - Intronic
1049108266 8:140626921-140626943 CAGTGGGAATGAGAAGCCCAGGG - Intronic
1049847640 8:144810825-144810847 ACGTCTGGATGAGAGGAACATGG - Intronic
1050235030 9:3568818-3568840 CTTTCTGGATGAGAGGCAAAAGG - Intergenic
1050366295 9:4876831-4876853 CAGTGTAGATGGGAGGTAGAGGG + Intronic
1051764595 9:20509016-20509038 CAGTGGGAATCAGAAGCACAAGG + Intronic
1053800636 9:41762353-41762375 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054144557 9:61552482-61552504 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054189067 9:61974505-61974527 CAGTGGGGATGAGGGGGACTTGG - Intergenic
1054464245 9:65483441-65483463 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1054649453 9:67614112-67614134 CAGTGGGGATGAGGGGGACTTGG + Intergenic
1056319039 9:85419445-85419467 TGGTGTGGATGAGAGCCAAAGGG + Intergenic
1056547557 9:87625460-87625482 GAGTGGGGAGGAGATGCACACGG + Intronic
1056955734 9:91079653-91079675 CAGTGTGCATGAGAACCACCTGG + Intergenic
1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG + Intronic
1059462313 9:114440763-114440785 CAGAGATGATGAGCGGCACACGG - Intronic
1059509130 9:114827638-114827660 TAGTGGGGAGGAGGGGCACAAGG + Intergenic
1059855162 9:118388375-118388397 CAGGGTAGATGATAGTCACAAGG + Intergenic
1060111675 9:120911122-120911144 ATGTGTGGCTGAGAGCCACAGGG + Intronic
1060209713 9:121702060-121702082 CCGTGTAGATGAGCGGCACAGGG + Intronic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1061424782 9:130492166-130492188 CAGTGTGGAGGCGCGGCACTTGG + Intronic
1061579068 9:131525798-131525820 CAGTGTTGATCTGCGGCACAGGG - Intronic
1061765775 9:132880297-132880319 TAGTGTGGATGAAGGGCACAGGG - Intronic
1186559008 X:10590418-10590440 CACTGTGGAAGAGTGGCACAGGG - Intronic
1187030924 X:15487479-15487501 CATTGTGGATGCAAGGAACATGG + Intronic
1189941897 X:46133025-46133047 CAGTGTGGATGAAAGGCAACAGG + Intergenic
1190107293 X:47569669-47569691 CAGGCTGGATGGGGGGCACATGG + Intronic
1192172266 X:68864196-68864218 CAGTGTGGGAAAGAGGGACAGGG - Intergenic
1194579882 X:95659070-95659092 CAGTGTGGCTGTCAGGCAGAGGG - Intergenic
1194656040 X:96575029-96575051 GGGGGTGGATGAGGGGCACAAGG - Intergenic
1195924389 X:110011231-110011253 CAGTTTTGATGAGATGGACAAGG + Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1197136135 X:123061573-123061595 CAGTGAGGATGACAGGCATATGG - Intergenic
1197253704 X:124240691-124240713 CAGTGGGGATGAGAAAAACATGG - Intronic
1198809473 X:140520942-140520964 CAGTGTGGCTAAGAGGTAGAAGG + Intergenic
1199850132 X:151720275-151720297 CATTGTGGATGGGAAGCAGATGG - Intronic
1200101860 X:153692322-153692344 CAGTGGGGGTGATGGGCACAGGG - Intronic