ID: 1002409548

View in Genome Browser
Species Human (GRCh38)
Location 5:179062702-179062724
Sequence TTTGAAGCCCAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002409542_1002409548 5 Left 1002409542 5:179062674-179062696 CCCAGAAGGAGTTCAGCGTGGTT 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
1002409543_1002409548 4 Left 1002409543 5:179062675-179062697 CCAGAAGGAGTTCAGCGTGGTTT 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002409548 Original CRISPR TTTGAAGCCCAGAAGGAGGC AGG Intronic
900238175 1:1602206-1602228 TTTGCAGTCCAGGAGGTGGCTGG - Intergenic
902286846 1:15412623-15412645 GTGGAAGCCCAGGAGAAGGCAGG - Intronic
902683128 1:18057950-18057972 CAAGAAGCCAAGAAGGAGGCTGG - Intergenic
903930345 1:26858359-26858381 ATTGAAGCCCAGAGGCAGGAAGG + Intergenic
904084100 1:27891966-27891988 TTTGAAGCTCAGAGGGAGATGGG - Exonic
904476825 1:30770446-30770468 TCTGAAGCCCAGAGGGGCGCAGG - Intergenic
905110279 1:35589733-35589755 TTTGCAGCCAAGACAGAGGCAGG - Intronic
906571069 1:46841053-46841075 GTTGAAGACCAGAAGGTTGCAGG + Intergenic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
906860334 1:49352526-49352548 CTGGAAGGCCAGAAGGAGGGGGG - Intronic
907263397 1:53238767-53238789 TTCAAAGCCCAGAGGTAGGCAGG - Intergenic
909701659 1:78531137-78531159 TTTGATGGCCAGAAGTAGGTGGG + Intronic
909810140 1:79923488-79923510 TTGGAAGCTCAGAAGAAGACAGG + Intergenic
911565781 1:99461825-99461847 TTTGAAATCTAGAGGGAGGCAGG + Intergenic
912241558 1:107915463-107915485 TTTGGAGACCAGACAGAGGCAGG + Intronic
912501582 1:110126189-110126211 GTTGGAGGACAGAAGGAGGCAGG + Intergenic
912846680 1:113080672-113080694 TTAAAAGACCAGAAGCAGGCCGG - Intronic
912858111 1:113189855-113189877 TATCAGGACCAGAAGGAGGCAGG - Intergenic
913716799 1:121543305-121543327 TTTGAACACCAGTAGGAGGGAGG - Intergenic
915033083 1:152900980-152901002 TCTGGAGCCAATAAGGAGGCTGG - Intergenic
915530704 1:156500745-156500767 TTTGGAGCCCGAAAGGAGGAAGG - Exonic
917693238 1:177490515-177490537 CTTGAAACCCAGCAGGATGCTGG - Intergenic
918602099 1:186375678-186375700 TATGGCGCCCAGAAGGGGGCGGG + Intronic
919864564 1:201770715-201770737 TTTGAAGGCCACATGTAGGCTGG + Intronic
920615404 1:207487472-207487494 TTTGAAGAGAGGAAGGAGGCAGG + Intronic
920674519 1:208029881-208029903 GTTAAAGCCCAGAAGGCAGCTGG - Intronic
922764484 1:228150091-228150113 CTTGAGGCCCCGAAGGAGGGAGG + Intronic
922866188 1:228863376-228863398 TTTGAATCTAAGAAGGAAGCAGG + Intergenic
923184617 1:231558900-231558922 TTTGCAGCTCAGAATGAGTCAGG + Intronic
923550360 1:234958614-234958636 ATTGAGGCCCAGAAAGGGGCAGG - Intergenic
924632194 1:245751748-245751770 TGCAAAGCCCAGAAGGTGGCTGG + Intronic
1062880965 10:977507-977529 TTTGTAGCCCAGACCCAGGCTGG - Intergenic
1064083032 10:12323759-12323781 TTAGAAGCCAAGCAGCAGGCTGG - Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1064490587 10:15851570-15851592 TTTGAAGCCTTGAAGCAGGCAGG - Intronic
1064554945 10:16538732-16538754 TCTAAACCCCAGAACGAGGCAGG - Intergenic
1065964834 10:30762707-30762729 TTTGAGCCCCAGAAGGAGACTGG + Intergenic
1066049127 10:31618957-31618979 TTTGGAGCCAAGCAGGAGGTGGG + Intergenic
1069314461 10:67080057-67080079 TTTGGATCCCAGCAAGAGGCAGG - Intronic
1070572603 10:77651265-77651287 TTTAAAGCCAAGGATGAGGCAGG + Intergenic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1071321740 10:84466807-84466829 TTAGAAGGCAAGAAGGAGGCCGG - Intronic
1074443845 10:113501793-113501815 TTGGAAGCCCAGAGTGTGGCTGG - Intergenic
1075101036 10:119506422-119506444 TTGGAACTCCAGAAGGAGTCTGG + Intronic
1076406456 10:130215310-130215332 TCAGAAGCCCAGAAGGACCCAGG - Intergenic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076799705 10:132814917-132814939 GTTGAAGACAAGAAAGAGGCAGG + Intronic
1077201352 11:1309166-1309188 TGTGAGCCCCAGATGGAGGCGGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077237253 11:1487694-1487716 TGTGAAGCCCTGTAGGAGTCAGG + Intronic
1077353492 11:2103883-2103905 TTCGAAACCCTGAAGGAGTCAGG + Intergenic
1077661104 11:4069301-4069323 TTTGAACCCCAGCTGGTGGCTGG + Intronic
1080534436 11:33207775-33207797 TTTGAAGCCCTGCAGGAAACTGG - Intergenic
1081835501 11:46150067-46150089 TGGGAAGCCCAGATGGAGGTTGG + Intergenic
1083484618 11:62975515-62975537 TTTTCAGCCCAGAAGGAAGGAGG + Intronic
1084172982 11:67409536-67409558 TTTGAGGCCCAGCAGCTGGCAGG + Exonic
1084238275 11:67802108-67802130 TTTAAAACCCAGCAGAAGGCTGG - Intergenic
1084378015 11:68791730-68791752 TTTGTAGACCAGTAGTAGGCTGG + Intronic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1085120800 11:73966194-73966216 TGTGAAGCCCGGTTGGAGGCAGG + Exonic
1085200090 11:74696700-74696722 TTTGGAGCCCACAGGGAGCCTGG + Intronic
1086108328 11:83171118-83171140 TTTGCAGTCCAGAGGGAGGCAGG - Intronic
1086189281 11:84059398-84059420 GTGGAAGCCCTGAAGGAAGCAGG - Exonic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1087566436 11:99865171-99865193 ATTGAAGCACAGAAGGAAGGAGG - Intronic
1087602767 11:100337789-100337811 TTTGAAGCTCAGAGGGAGATGGG + Intronic
1088709233 11:112491741-112491763 TTTCAAACCCCGATGGAGGCAGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088963571 11:114695426-114695448 TAAGAAGGCCAGATGGAGGCTGG + Intronic
1090467285 11:126945649-126945671 TTAGAAGCCCTCAAGGAGGAGGG - Intronic
1092205388 12:6611684-6611706 TTTGAGGCCCAGAGACAGGCTGG - Intergenic
1095464658 12:42477587-42477609 TTTGTAGCACAGAAGGAAGAAGG + Intronic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1096512887 12:52141497-52141519 TCTGAAGACCTGAAGGAGGCGGG - Intergenic
1096606192 12:52768252-52768274 TCTGAAGCCCAGATGTAGGGAGG + Exonic
1096982413 12:55736112-55736134 TGTGAGGGGCAGAAGGAGGCTGG - Intergenic
1097725205 12:63067169-63067191 GTGGAAGCCCATAGGGAGGCGGG + Intergenic
1101135765 12:101741403-101741425 TATGAGGCCAAGAATGAGGCTGG - Intronic
1101538399 12:105641810-105641832 CCAGAAGTCCAGAAGGAGGCAGG + Intergenic
1102968997 12:117151214-117151236 CGAGAAGTCCAGAAGGAGGCGGG + Intronic
1103193311 12:119020819-119020841 TTTGGAACCCAGAATGAGGAAGG + Intronic
1103212641 12:119178229-119178251 TTTGTAGCCAAGAAGCAGGTGGG - Intergenic
1106406762 13:29481257-29481279 TATGAAAGCTAGAAGGAGGCAGG + Intronic
1107602542 13:42028365-42028387 TTTTTAGCCCAGAAGGAGCCTGG - Intergenic
1110520360 13:76469009-76469031 TTAGAAGAGTAGAAGGAGGCAGG + Intergenic
1110562863 13:76927967-76927989 TTAGAAGCACACAGGGAGGCAGG - Intergenic
1112620527 13:101049808-101049830 TTTGAAGCCAAGGAGGAAGGAGG + Intergenic
1113415491 13:110125430-110125452 ATTGAAGGCCAGCAGGGGGCTGG + Intergenic
1114482298 14:23043342-23043364 CTTGGTGCCAAGAAGGAGGCTGG - Exonic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1116175942 14:41470433-41470455 TCTGAAGGCCTGAATGAGGCTGG - Intergenic
1117200353 14:53383789-53383811 TTAGAAACCAAGAATGAGGCTGG - Intergenic
1117538164 14:56721412-56721434 TTTGAAGCCCAGCAGAGGGAAGG + Intronic
1118755274 14:68838603-68838625 TTTGAAATCCAGCAGGAAGCTGG - Intergenic
1119350506 14:73960934-73960956 GGTGAAGCTCAGAAGTAGGCAGG + Intronic
1120968508 14:90188303-90188325 TTTCTAGCCTAGAAGTAGGCAGG + Intergenic
1121037196 14:90716144-90716166 TTTACAGCCAAGAAGGAGGGTGG + Intronic
1121494978 14:94385869-94385891 TTTGAAGCCCAGAGAGGGTCAGG + Intronic
1121527270 14:94627835-94627857 CTTGAAGCCCACAAAGGGGCTGG - Intergenic
1122097809 14:99384231-99384253 ATTCAGGCCCAGAGGGAGGCGGG + Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1125903011 15:43366598-43366620 TTTGAAGATGAGAAGGTGGCAGG - Exonic
1126761817 15:51976646-51976668 TTTAAAATCCTGAAGGAGGCCGG + Intronic
1129771325 15:78205110-78205132 CTTGAAGCCCAGCAGGAGAAGGG - Intronic
1129934051 15:79434556-79434578 TTTAAAGGCCAGGAGAAGGCAGG + Intronic
1130346245 15:83048378-83048400 TTTGTAGCCCAGAAGACGACAGG + Intronic
1132533771 16:467226-467248 TTTGGAGGCCACAGGGAGGCAGG + Intronic
1133136650 16:3717181-3717203 ATGGGAGCCCTGAAGGAGGCTGG - Intronic
1134462600 16:14442551-14442573 CTAGAAGCCCTGAAGGAGACTGG + Intronic
1135875751 16:26198490-26198512 TTTGAAGCCCAGCAGAAGGAAGG - Intergenic
1136127531 16:28195049-28195071 GTTGAAGCCCACAAGGAGTGAGG - Intronic
1136411457 16:30079891-30079913 ATTGAAGCAGGGAAGGAGGCTGG - Intronic
1139296468 16:65905890-65905912 TTTGTAGCCAAGAAATAGGCTGG - Intergenic
1139327862 16:66165944-66165966 TCTGGAGCCCAGAAGCAGACTGG + Intergenic
1139823734 16:69740755-69740777 TTAAAAGCACAGATGGAGGCCGG + Intergenic
1140117803 16:72057818-72057840 ATGGAAGCCTAGCAGGAGGCTGG + Intronic
1140118022 16:72059533-72059555 ATGGAAGCCTAGCAGGAGGCTGG + Intronic
1140120038 16:72075570-72075592 ATGGAAGCCTAGCAGGAGGCTGG + Intronic
1143018628 17:3904818-3904840 TGTGAGTCCCAGAAGGGGGCTGG + Intronic
1143305732 17:5945238-5945260 TTTGCAGTCCAGCAGGTGGCTGG - Intronic
1143772754 17:9179005-9179027 TTTCAAGCCCAGGAGGAGGGTGG + Intronic
1144785959 17:17831729-17831751 TCTGAGGCCCAGAAGGAGACAGG + Intronic
1146847077 17:36188902-36188924 CTTGGACCCCAGAAGGGGGCTGG - Intronic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149132017 17:53314199-53314221 TTTGGAGCCAAGTAGGAGGGAGG - Intergenic
1151005738 17:70433876-70433898 TTTAAAGGGCAGAAGGGGGCAGG - Intergenic
1151146493 17:72046456-72046478 GCTGAAGCACAGAAGGTGGCTGG + Intergenic
1151908722 17:77066986-77067008 CTTGAATCCCAGCAGGAGTCTGG - Intergenic
1152174706 17:78780219-78780241 TTTTAATCACAAAAGGAGGCTGG + Intronic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153710882 18:7797643-7797665 TTTGAAGGCCAGAAGAAGTGAGG - Intronic
1154044219 18:10889167-10889189 TTTGAAACCTAGAAGATGGCAGG - Intronic
1157516657 18:48316101-48316123 TTTTAAGCCCAGCAGGAGCCGGG - Intronic
1159703078 18:71654464-71654486 ATTCAAGCCCAGAAAGAAGCAGG + Intergenic
1159944905 18:74437092-74437114 TTTGCAGGCCTGAGGGAGGCCGG + Intronic
1160172530 18:76566902-76566924 TGTGAAGGCCAGAGGGAAGCAGG - Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160965210 19:1744442-1744464 TCTGGAGGCCAGGAGGAGGCCGG - Intergenic
1160972761 19:1776704-1776726 CTTGAACCCCCGGAGGAGGCGGG - Exonic
1161203413 19:3028510-3028532 TTTGGAGCCCAGGAAGGGGCGGG - Intronic
1161772865 19:6240780-6240802 TGCGAAGCACAGAAGGACGCAGG - Intronic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1162403335 19:10459231-10459253 TTTGCAGCCCAGTAGGACGAGGG + Intronic
1162817677 19:13206309-13206331 TTTGAAAGCGACAAGGAGGCCGG - Intergenic
1163173724 19:15550495-15550517 TGTGAACAACAGAAGGAGGCAGG + Intronic
1163638608 19:18449428-18449450 TGGGAAGCCCAGCACGAGGCAGG + Intronic
1163929409 19:20374641-20374663 TTTAAAGCCCAAAATCAGGCCGG + Intergenic
1165953596 19:39488483-39488505 TCTAAAGGCCAGAGGGAGGCAGG - Intronic
1166073072 19:40397839-40397861 TTTGAGGCCCCGACGCAGGCGGG + Exonic
1166103206 19:40583441-40583463 GTTGCAGCCCAGGAGGAGGAAGG - Exonic
1167705897 19:51080966-51080988 TTTGAATCCCAGAATGTGGCGGG - Intronic
1168298300 19:55388668-55388690 TTTCTAGCCCAGAAGGGTGCAGG + Intronic
1168298577 19:55390055-55390077 TTTGCAGCCCACAAGCTGGCAGG + Intronic
925142307 2:1558715-1558737 TAAGAAGATCAGAAGGAGGCAGG - Intergenic
925473101 2:4183926-4183948 TTTAATCCCCAGAAGGATGCTGG + Intergenic
927644021 2:24863988-24864010 TTTGAAGCTCTATAGGAGGCCGG + Intronic
928393797 2:30929096-30929118 TTTGCAGACAGGAAGGAGGCAGG - Intronic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
931485032 2:62682108-62682130 TTTGACATTCAGAAGGAGGCTGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933777263 2:85778761-85778783 TTCCCAGTCCAGAAGGAGGCAGG + Intronic
934669354 2:96199859-96199881 TTTTAATCACAAAAGGAGGCTGG + Intronic
935400087 2:102651219-102651241 TTTGAAAAACAGAAGCAGGCAGG - Intronic
935940433 2:108232368-108232390 TTTCCAGGCCAGAAGGAGGTGGG + Intergenic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
939171337 2:138699759-138699781 TTTGCACCCCAGCAGGAAGCTGG - Intronic
939842869 2:147209976-147209998 TGTGAATCCCAGAAGCAGGCTGG + Intergenic
941237901 2:162997878-162997900 TTTCAAGACCACAAGGAGGATGG - Intergenic
941519132 2:166516881-166516903 TTTGAACACCAGAGGGCGGCAGG - Intergenic
941683343 2:168422454-168422476 TTTGAACCCCAGTAGGAAGAGGG + Intergenic
941809990 2:169745917-169745939 TTTGCAGCTGAGAAGGAGGGAGG + Intronic
942702762 2:178732101-178732123 TGTGAGGCCCAAAATGAGGCTGG - Exonic
942924239 2:181412630-181412652 TTGGAATACCAGAAGGAGACAGG + Intergenic
943789730 2:191918569-191918591 TTGGGAGCCCAGAAGGAGCCGGG + Intergenic
944130584 2:196343731-196343753 TTAGAATCCCAGAAGTTGGCTGG + Exonic
944210486 2:197201832-197201854 TGTGAATCCCAAAAGGGGGCAGG - Intronic
944563545 2:200964819-200964841 TTAAAAGCCCAGAAGGAGTCAGG + Intergenic
945280815 2:208033885-208033907 TTTGAAGGTCAGAAGCAGGATGG - Intergenic
946032114 2:216713635-216713657 ATAGAAGCCTAGAAGAAGGCTGG + Intergenic
946136489 2:217651820-217651842 GTTGAATGCCAGCAGGAGGCAGG - Intronic
946397941 2:219452702-219452724 GTTGGTGCCCTGAAGGAGGCTGG + Intronic
946821932 2:223639061-223639083 TTTGAAAGGCAGAAGGATGCAGG - Intergenic
947505025 2:230701826-230701848 TTTAAAGTGCTGAAGGAGGCCGG - Intergenic
948299147 2:236888899-236888921 ATTGAGGCTCAGGAGGAGGCAGG - Intergenic
948504843 2:238421865-238421887 TGTGAAGCCCAGGTGCAGGCAGG + Intergenic
1170898219 20:20435680-20435702 TTTTTAGCAAAGAAGGAGGCAGG + Intronic
1172060393 20:32183427-32183449 TTTGAAGACTAGCAAGAGGCTGG + Intergenic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1173772972 20:45679868-45679890 TTTGTAGGCCAGAAGGGGGTGGG - Intergenic
1173933357 20:46840137-46840159 TCTGGAGCCCTGAAGCAGGCAGG + Intergenic
1173933475 20:46841063-46841085 TTTGAAGGACTGAAGGAGGATGG + Intergenic
1173993439 20:47320157-47320179 TTTGAAGCACAGAAGTGGGTTGG + Intronic
1176090002 20:63314539-63314561 TGGGAAGCCCAGAGGGAAGCTGG - Intronic
1179449295 21:41457478-41457500 TTTGATGTCAAGAATGAGGCAGG + Intronic
1185153244 22:49178470-49178492 TGTCAAGCCCAGAAAGAGTCCGG + Intergenic
950116023 3:10450727-10450749 TCTGGAGCCCAGGAGGAGGTGGG + Intronic
950485417 3:13270509-13270531 AGTGAAGCCCAGAAAGTGGCAGG - Intergenic
951738951 3:25898796-25898818 TTTGAAGCAAAGAAGTAGGCTGG - Intergenic
952562315 3:34609599-34609621 TTTGAAGCAAAGAAAGAGGAAGG - Intergenic
953823970 3:46233984-46234006 ATTGCAGCCCAGGAGGTGGCAGG - Intronic
956433265 3:69208493-69208515 TTAGAAACCCAGGAGAAGGCTGG - Intronic
957649183 3:82977392-82977414 TTTCAACCCCAAAAGCAGGCAGG + Intergenic
958427635 3:93997633-93997655 TTTGTAGTTCAGAAGGAGACTGG - Intronic
958827946 3:99054821-99054843 TTTGAAGGCAAGAAGGAGAGAGG + Intergenic
958856318 3:99390509-99390531 TCTGAAGACCAGAAGGAAGCAGG - Intergenic
959276094 3:104278891-104278913 TTTTAAGCCCAGAAGTAAACTGG - Intergenic
960405348 3:117252924-117252946 TTTGAAGTCCTGAGGGAGACTGG + Intergenic
960877937 3:122315476-122315498 TGGGAAGGCCAGAAGGGGGCTGG - Intergenic
961661803 3:128473012-128473034 TGGGAGGCCCAGGAGGAGGCTGG + Intergenic
961828929 3:129613346-129613368 TGTGAAGCCCTGACGGGGGCGGG - Intergenic
963076497 3:141352303-141352325 GTGTAACCCCAGAAGGAGGCAGG - Intronic
963965285 3:151361995-151362017 TTTGGAATCCAGAAGGAGGTAGG + Intronic
965059717 3:163769871-163769893 TTAGAAGACCAGAAGCAGACAGG + Intergenic
965551953 3:169975372-169975394 GTTGAAGCCAAGAAGCAGACAGG + Intronic
965682601 3:171266838-171266860 TTTGGAGAACAGAAGGAAGCCGG - Intronic
965685989 3:171303258-171303280 TCTGAAGCATAGAAAGAGGCAGG - Intronic
966167696 3:177039540-177039562 TCTGAAGCCCCAAAGCAGGCTGG + Intronic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
966250350 3:177859057-177859079 TTGGAATACCAGAAGGAGACAGG - Intergenic
966765112 3:183454315-183454337 CTTGTTGCCCAGAAGGAGTCAGG + Intergenic
967072042 3:185970963-185970985 TTTGAAGCCAAGAAGCAACCTGG - Intergenic
967095645 3:186175182-186175204 TTTCCAGCCAAGATGGAGGCTGG + Intronic
968617137 4:1582495-1582517 TGGGAAGACCAGGAGGAGGCTGG + Intergenic
968837365 4:2975006-2975028 TTCAAAGACCAGAATGAGGCCGG + Intronic
969909355 4:10429023-10429045 TTTGAAGATCAGAAGGTAGCAGG - Intergenic
970168142 4:13261800-13261822 TTGGAAGCTCTGAAGCAGGCTGG + Intergenic
970345607 4:15149749-15149771 TTTGCATCCTAGCAGGAGGCAGG - Intergenic
971369392 4:26003666-26003688 TTTGATGCCAAGGAGTAGGCAGG + Intergenic
971476775 4:27080113-27080135 TTTAATGCCCAGAAGGCAGCTGG - Intergenic
973038592 4:45441654-45441676 TTTGAAGCCCAGAAAAACACTGG - Intergenic
973936175 4:55849184-55849206 CTTGAACCCCTGAAGGAGGAAGG - Intergenic
976988164 4:91328067-91328089 TTTAAGGCTCAGAAGAAGGCAGG - Intronic
977413858 4:96703910-96703932 TGTGGAGGCCAGAAAGAGGCTGG - Intergenic
977714565 4:100167405-100167427 TATGAAGCACACAAGCAGGCTGG - Intergenic
978955683 4:114609688-114609710 TTTAAAGCCCATATAGAGGCTGG - Intronic
978961840 4:114689073-114689095 TTTAAAGCCCAGAAGGGGAGGGG - Intergenic
980949762 4:139363210-139363232 TTTGAAGAAGAGAAGGAGGGAGG - Intronic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
982401927 4:154977600-154977622 TGTAAAGCCCCGTAGGAGGCTGG + Intergenic
984182199 4:176497662-176497684 TTGAAATCCCAAAAGGAGGCTGG - Intergenic
984862934 4:184256058-184256080 TTTTTAGCCTGGAAGGAGGCTGG - Intergenic
985559490 5:575713-575735 TTAGAACCCCAAAAGGAGGGAGG + Intergenic
985785502 5:1891516-1891538 TGTGATGCCCAGAAAGAGACAGG + Intergenic
986742124 5:10713411-10713433 TTTCAAGCCCAGGAGGAGCAGGG + Intronic
989392524 5:40916394-40916416 GTTGAAGCACAGCAGTAGGCAGG - Intronic
989675605 5:43968791-43968813 TTTTAAGACTAGAAGGGGGCTGG - Intergenic
989961758 5:50424453-50424475 TTTGAACACCAGTAGGAGGGAGG + Intronic
990124889 5:52502630-52502652 TCTGCAGCGTAGAAGGAGGCCGG + Intergenic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
991138803 5:63214924-63214946 TTGGAAGCCAAGAGTGAGGCAGG - Intergenic
991156722 5:63445144-63445166 TTTCAAACCCATAAGGAGGTGGG + Intergenic
992207190 5:74442448-74442470 TTTGGAGCCCAGAAGCAGGAAGG + Intergenic
992364319 5:76076561-76076583 TTTGAAGTCCAGGATGAGGGAGG + Intergenic
993626071 5:90226267-90226289 TTTGAAGGAGAAAAGGAGGCAGG - Intergenic
993753886 5:91703331-91703353 TTTGGATGCCAGAAAGAGGCTGG + Intergenic
998563098 5:143190011-143190033 TTTGGAGGACAGAAGGAGGGGGG + Intronic
999226649 5:150030895-150030917 GTTGAAGGTCAGTAGGAGGCTGG + Intronic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999579191 5:153015635-153015657 TTTGCAGACCAGAAGGAAGTGGG + Intergenic
1000392661 5:160741343-160741365 TATGAAGTCCAAAAGGAGGATGG + Intronic
1001499723 5:172221205-172221227 TCAAAATCCCAGAAGGAGGCTGG + Intronic
1001755395 5:174164701-174164723 TGAGAAGCTCAGAAGAAGGCAGG - Intronic
1002281727 5:178134208-178134230 TATGAAGCAGAAAAGGAGGCAGG + Intronic
1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG + Intronic
1003218229 6:4135136-4135158 TTTGCACCCCAGAAGCAGCCCGG + Intronic
1003412895 6:5881125-5881147 TTTAAAGCCAAGAGGGATGCAGG + Intergenic
1004148890 6:13095922-13095944 TTTGAAACCCAAAAGGTAGCAGG + Intronic
1006810859 6:36819728-36819750 TATGAAGAACAGAAGGATGCAGG - Intronic
1007122134 6:39391178-39391200 TCTGAAGACCAGAAGTAGGACGG + Intronic
1007205707 6:40148846-40148868 TTTGAAGCCAAGAGGGAGTCAGG + Intergenic
1007798411 6:44370221-44370243 TTTGAATCCCAGCAGGAGGGTGG + Intronic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1012079228 6:94735375-94735397 TATGGATCCCAGAAGGAAGCAGG + Intergenic
1012354154 6:98292125-98292147 TTGAAAGCCCAGAAAGAAGCAGG - Intergenic
1013010967 6:106119568-106119590 TTGGAAGCAGAGCAGGAGGCAGG + Intergenic
1013539932 6:111098007-111098029 TTTGAAAACCTGATGGAGGCCGG + Intronic
1013560744 6:111302523-111302545 TTTGTAGCACATAGGGAGGCAGG + Intronic
1014579584 6:123120574-123120596 CTTGAAGTCCAGTATGAGGCAGG - Intergenic
1015554265 6:134444546-134444568 TATGAAAACCACAAGGAGGCTGG - Intergenic
1017556211 6:155572983-155573005 TTAGAATCCCAGAAGGAGAAAGG - Intergenic
1018905586 6:168073600-168073622 TTTGAGGCACAGAAGGGGCCGGG + Intronic
1019775954 7:2912368-2912390 TGTAGAGCCCAGAAGGTGGCAGG - Intronic
1021279652 7:18702082-18702104 TTGGAAGCAAAGAAGCAGGCTGG + Intronic
1023379164 7:39588741-39588763 TTTAAAACTCAGAAGGAAGCAGG - Intronic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1024241296 7:47438579-47438601 CTTCAAGACCAGAAAGAGGCAGG + Intronic
1024324219 7:48096068-48096090 GTTGAGGCCTAGTAGGAGGCTGG + Intronic
1026441001 7:70444080-70444102 TGTAAAGCCAAGGAGGAGGCTGG + Intronic
1027664653 7:81030338-81030360 TTTGCAGCAAAGTAGGAGGCAGG - Intergenic
1028235297 7:88354069-88354091 TTATAAGACCAGAAGTAGGCAGG - Intergenic
1031985832 7:128164218-128164240 TGAGAAAGCCAGAAGGAGGCAGG + Intergenic
1032462070 7:132119200-132119222 TGTGATGCCTAGAAGGATGCTGG - Intergenic
1032481580 7:132251395-132251417 TCTGCAGCCAAGAAGAAGGCGGG + Intronic
1032926662 7:136613893-136613915 TTAGAATGCCAGAAGGAGACAGG - Intergenic
1035062704 7:156080831-156080853 TGTGAAACCCAGAGAGAGGCTGG + Intergenic
1037524822 8:19714471-19714493 TTGGAATTCCAGAAGGAGACTGG - Intronic
1037728257 8:21501920-21501942 GTTAAAGCCCTGAAGGATGCAGG - Intergenic
1038358009 8:26848215-26848237 TTTAAATCCCAGAAGTAGCCAGG - Intronic
1040873023 8:52120494-52120516 TTTCAAGATCAGAAGGAGGCAGG + Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1042229260 8:66540442-66540464 CCTGCAGCCCAGAATGAGGCTGG - Intergenic
1042875206 8:73435202-73435224 TTAGGAACCCAGAGGGAGGCAGG - Intronic
1044198683 8:89409020-89409042 TCTGAAGCCCTGAGGGAGCCAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045990026 8:108295934-108295956 GTTGAAGGCAAGAAGGAGACAGG - Intronic
1047002936 8:120590979-120591001 GTTGAAGCCTATAATGAGGCAGG - Intronic
1048963463 8:139598358-139598380 TTTGGAGCCCAGCAGGAAACAGG - Intergenic
1050224380 9:3434686-3434708 TTTGGAGTGCAGAAGGAGGGTGG - Intronic
1050645671 9:7716965-7716987 TTTGAAAACCAGCACGAGGCAGG + Intergenic
1052849556 9:33368649-33368671 TTCAAAGCCCAGAAGGAGAGGGG + Intronic
1057239385 9:93394912-93394934 TTTGGAGGCCAGAAGGAAGTGGG - Intergenic
1057885462 9:98826553-98826575 TCCGAAGGCCAGGAGGAGGCTGG - Intronic
1060506111 9:124199478-124199500 TTTGTAGCCGAGATGGAAGCTGG - Intergenic
1062351601 9:136142358-136142380 TTTGAACCCCAGAAGCATGCAGG - Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1189068259 X:37835088-37835110 TTTTAAGCCCATAAGGCGGCTGG - Intronic
1190046573 X:47115959-47115981 TTTAAAGTCCTGAAGGAGGCTGG + Intergenic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1193502052 X:82289204-82289226 TTTGAAGCCTTGAAGGATGTAGG - Intergenic
1193625475 X:83814993-83815015 TTTTAAGACCTGAAGAAGGCAGG - Intergenic
1194714406 X:97274168-97274190 TTTGAAAACCAGAAGGACTCTGG + Intronic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1197969402 X:132099474-132099496 TTTGAAGCCCATAACAAAGCAGG - Exonic
1199749048 X:150797746-150797768 TAGGAAGCCCAGAAATAGGCCGG + Intronic
1200121120 X:153791064-153791086 TCTGAAGAGCGGAAGGAGGCAGG - Intronic