ID: 1002411615

View in Genome Browser
Species Human (GRCh38)
Location 5:179083212-179083234
Sequence ACCTATAAGAGACATTTGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002411610_1002411615 5 Left 1002411610 5:179083184-179083206 CCTTTATTAGCTTCTGATTCATA 0: 1
1: 0
2: 0
3: 24
4: 251
Right 1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1002411609_1002411615 23 Left 1002411609 5:179083166-179083188 CCAAATGGAAAGTGTGATCCTTT 0: 1
1: 0
2: 0
3: 23
4: 194
Right 1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002411615 Original CRISPR ACCTATAAGAGACATTTGGG GGG Exonic
901695587 1:11005457-11005479 AGCTATAAAAGACATTTGAGGGG + Intergenic
904573449 1:31485200-31485222 AGCTATACAAGACATTTGGAGGG - Intergenic
905550363 1:38833096-38833118 ACAAATAAGAGACATTTCAGTGG + Intergenic
909311204 1:74151697-74151719 ACCTGTAAGAGAGTTTTGGCTGG - Intronic
909567184 1:77066297-77066319 ACCTAAAAGAGAAATTTGTGTGG + Intergenic
911486999 1:98515030-98515052 ACCTAAAAGAGACATTATGTAGG - Intergenic
911737519 1:101354127-101354149 AATTCAAAGAGACATTTGGGTGG - Intergenic
912833773 1:112977423-112977445 ACCTGTAATAGCTATTTGGGAGG + Intergenic
913299088 1:117351697-117351719 ACATATAAGAGATACTTGTGAGG - Intergenic
915482890 1:156199343-156199365 ATCACTAAGTGACATTTGGGAGG - Intronic
916874364 1:168953226-168953248 AACTATAAGATAAATTTGCGTGG - Intergenic
918651419 1:186968030-186968052 ACCTATGAGAAACAATGGGGAGG + Intronic
920552797 1:206878267-206878289 ATCTATAGGAGAAATTGGGGAGG - Intergenic
921330841 1:214033856-214033878 ATGTATACAAGACATTTGGGAGG + Intronic
924025804 1:239831729-239831751 ACATATAAGTGCCATGTGGGAGG + Intronic
1064524063 10:16234751-16234773 TCCTATAAGAGAGATTTGTTTGG - Intergenic
1064932913 10:20647294-20647316 ACCTATAAAAGACAGTTCAGAGG + Intergenic
1066061799 10:31730726-31730748 ATCTATGAAAGACATTTAGGGGG - Intergenic
1066280369 10:33911466-33911488 AGATTTTAGAGACATTTGGGAGG + Intergenic
1067107632 10:43376448-43376470 AGCCATAGGAGACAGTTGGGCGG - Intergenic
1067516212 10:46947607-46947629 AAATACAAGAGAAATTTGGGGGG - Intronic
1067933107 10:50583235-50583257 ACCTTTAGGAGATATTGGGGAGG - Intronic
1070049574 10:72874582-72874604 CTCTATTAGACACATTTGGGAGG - Intronic
1071385935 10:85121371-85121393 AGGTAAGAGAGACATTTGGGGGG - Intergenic
1071516785 10:86303032-86303054 AGGTATAAGAGATATTTTGGGGG + Intronic
1073172741 10:101525622-101525644 ACCTAATATAGAGATTTGGGGGG + Intronic
1075370658 10:121932037-121932059 ACTAATAACAGACATTTGGAGGG + Intergenic
1078741276 11:14068573-14068595 ACCTAAAAGAGACCCTTGGCAGG - Intronic
1082095753 11:48127878-48127900 ACCTACAAGATACATGTGGCGGG + Exonic
1086373239 11:86175320-86175342 ACACCTTAGAGACATTTGGGAGG - Intergenic
1093760115 12:22900270-22900292 GAGTATAAGTGACATTTGGGGGG - Intergenic
1094624762 12:32113201-32113223 ACGTCTAAGAGCTATTTGGGAGG + Intronic
1095916071 12:47480328-47480350 ATCTAAAAGAGAAATTGGGGAGG + Intergenic
1099100418 12:78432948-78432970 ACTTATAAGAAAAATTTGAGTGG - Intergenic
1100841151 12:98612751-98612773 TCCAATGTGAGACATTTGGGAGG + Intergenic
1102122954 12:110457187-110457209 ATCTTTAAGAGAACTTTGGGAGG + Intronic
1104790296 12:131477189-131477211 ATATAGAAAAGACATTTGGGAGG + Intergenic
1105865972 13:24460266-24460288 ACCTAAAAGACACATTGGTGGGG + Intronic
1106397111 13:29391876-29391898 ACCTATAATAGCACTTTGGGAGG + Intronic
1107626255 13:42288604-42288626 AACTATAAAAGATATTTTGGGGG - Intronic
1107700856 13:43046373-43046395 AGCTACAAGAGACATCTCGGTGG + Intronic
1109952169 13:69512823-69512845 ACCTCTGAGGGACATTTGGCTGG - Intergenic
1114161005 14:20167329-20167351 TCCTCTGAGGGACATTTGGGTGG - Intergenic
1116637031 14:47409687-47409709 ACCTCTAAGTGTCATCTGGGTGG - Intronic
1118069725 14:62232600-62232622 AGCTATAAATGAGATTTGGGTGG - Intergenic
1119391957 14:74296807-74296829 TTATATAAGAGAAATTTGGGAGG - Intronic
1122451989 14:101816527-101816549 ACCTATTAGAGACATTTTGAAGG + Intronic
1123976697 15:25560370-25560392 ATCTATAATACACATCTGGGTGG - Intergenic
1124642688 15:31406218-31406240 ACCTATAATAGCACTTTGGGAGG + Intronic
1127457145 15:59165406-59165428 ACAAATAATAGCCATTTGGGTGG + Intronic
1130628227 15:85538315-85538337 CCCTCAAAGAGAAATTTGGGTGG + Intronic
1133408439 16:5547348-5547370 CCTGATAATAGACATTTGGGTGG - Intergenic
1135204004 16:20466814-20466836 ATCTATAGGAGAAATTGGGGAGG + Intronic
1136579015 16:31140874-31140896 ACCTAGAAGGGAGATTTGGAAGG - Intronic
1138091206 16:54176163-54176185 ACAAATAAGAGGCATTTGGCAGG - Intergenic
1139155349 16:64434816-64434838 CCCTATAAGTGACAGCTGGGTGG - Intergenic
1140540352 16:75751198-75751220 ACATATAAAAGACATTTCAGTGG - Intronic
1141194382 16:81849027-81849049 ACCTATAAGAGATGCTTGGAGGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143495930 17:7312609-7312631 ACCTATTCCAGACAGTTGGGTGG + Intergenic
1145766516 17:27461637-27461659 GCCTCTAAGAAACATTTGGGAGG - Intronic
1146081382 17:29783764-29783786 ACCTTTAAGAGTAATTGGGGGGG + Intronic
1146235959 17:31162514-31162536 GCCTATGAAAGACATTTTGGGGG + Intronic
1147166614 17:38596752-38596774 ACCTATGAGTGCCTTTTGGGTGG - Intronic
1151013372 17:70527015-70527037 ACCTATTATAGCCCTTTGGGAGG + Intergenic
1155553658 18:26994501-26994523 ACCACTGAGAGCCATTTGGGAGG - Intronic
1157270085 18:46267776-46267798 ACCTATAAGAAATCTTTGGCTGG + Intergenic
1166725140 19:45022314-45022336 ACCTAGAAGAGGCAGTGGGGAGG - Intronic
1167385155 19:49158503-49158525 ACATAGAAGAGACATCGGGGAGG - Intronic
1168025181 19:53638719-53638741 ACCTATAATAGATAAATGGGCGG + Intergenic
930494413 2:52122944-52122966 ACTGATAAAAGACATTTGGATGG + Intergenic
932924532 2:75957192-75957214 ACTTATAAAAGACTTTTGGCCGG - Intergenic
933296195 2:80493811-80493833 ACTTGTAAAGGACATTTGGGTGG + Intronic
933884179 2:86702504-86702526 ACCTACAAGAGAAATGTAGGCGG + Intronic
935176709 2:100655266-100655288 ACCTAGAAGATTCATTTGAGAGG + Intergenic
939411560 2:141833270-141833292 AACTATAAGAGACATCAGGCTGG + Intronic
940385724 2:153069096-153069118 CCCTGTAGGAGACATTTGGGTGG + Intergenic
942990608 2:182196886-182196908 TCCTATATAAGACATTTGGTGGG + Intronic
943560446 2:189454983-189455005 ACCTATAATAGCAATTTGGGAGG + Intronic
945590612 2:211725650-211725672 AACTAAATGAGACATTTGGCAGG + Intronic
946663907 2:222029601-222029623 AACTAATGGAGACATTTGGGAGG + Intergenic
947093901 2:226544669-226544691 ACCTATAGGAGCAATCTGGGAGG - Intergenic
948740033 2:240040391-240040413 CCTTATAAGAGACACATGGGGGG - Intergenic
1169171143 20:3466678-3466700 TCCTATAAAGGAAATTTGGGAGG - Intergenic
1169246055 20:4025853-4025875 AGCTATGAGAGATTTTTGGGGGG - Intergenic
1169790383 20:9403920-9403942 ACCTTAAAGAGACATTTCAGTGG + Intronic
1169936850 20:10893062-10893084 ACTTACAAGAGTCAATTGGGTGG - Intergenic
1172458724 20:35098921-35098943 GACTGTAAGGGACATTTGGGGGG - Intergenic
1175614248 20:60379625-60379647 AGCTATAAAAAACATTGGGGGGG + Intergenic
1176990112 21:15485459-15485481 AACTATAAGTGACGATTGGGGGG + Intergenic
1179354192 21:40643238-40643260 ATCTCTAAGTCACATTTGGGTGG + Intronic
1181612677 22:24029095-24029117 ACCTATAACAGCACTTTGGGAGG + Intronic
1182896773 22:33865450-33865472 ACCTAAATGAGTCATTTGGTGGG + Intronic
1183243574 22:36676142-36676164 ACCCCCAAGAGATATTTGGGAGG - Intronic
949527903 3:4923521-4923543 AACTAAAAAAGACATTTTGGGGG + Intergenic
949835216 3:8261475-8261497 ACCTATAGGTCACATTTGGTAGG + Intergenic
950650938 3:14406267-14406289 ACCTATAATCAACACTTGGGAGG - Intronic
953064752 3:39458744-39458766 ACCTATCAGCAACATGTGGGTGG - Intergenic
955682776 3:61519429-61519451 AGCTACAAGTGAGATTTGGGTGG + Intergenic
957533483 3:81470887-81470909 AAATATAAGAGACATTTTGAAGG - Intergenic
957950880 3:87124900-87124922 ACACATTAGAGACATTTGCGTGG - Intergenic
961248132 3:125474843-125474865 TCCCATAGGAGACATGTGGGGGG - Intronic
964661811 3:159128227-159128249 ATTCATAAGAGAAATTTGGGAGG + Intronic
965740282 3:171866902-171866924 ACCTTTGAGAGACATTTAGAAGG + Intronic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
969842932 4:9896506-9896528 ACCTATAAAACACATTTGAGAGG - Intronic
971248754 4:24954042-24954064 ACCTATAGGACACATTGTGGAGG + Intronic
971884099 4:32420883-32420905 AGCTACAAGATAGATTTGGGTGG + Intergenic
972113198 4:35592304-35592326 ACATATCAGAGACATTCCGGTGG + Intergenic
974671181 4:65032305-65032327 CCTTCTAAGAAACATTTGGGAGG - Intergenic
974689734 4:65281395-65281417 AGCTATGAGAGACAGGTGGGTGG - Intergenic
976117926 4:81748005-81748027 ACCTATAAGAGTTTTTTTGGAGG - Intronic
977495024 4:97764372-97764394 AGCTATAAGATACATTAGGTTGG + Intronic
978534763 4:109749320-109749342 CCCTGTAAAAGACATTTGTGTGG + Exonic
979862394 4:125709599-125709621 AAATAGTAGAGACATTTGGGAGG + Intergenic
980010303 4:127587882-127587904 ACCTGGAAAACACATTTGGGGGG + Intergenic
982107573 4:152024191-152024213 ACTTAGGAGAGAGATTTGGGAGG - Intergenic
983759894 4:171393378-171393400 ATCTATAAGAATAATTTGGGAGG - Intergenic
985234035 4:187852986-187853008 TACTATAGGAGACATTTGTGAGG - Intergenic
986775266 5:11008348-11008370 CCTTATAAGAGAGATTTGGGGGG + Intronic
987228144 5:15865160-15865182 ACCCATCAGAGACCTTTTGGGGG - Intronic
989085278 5:37669667-37669689 ACCTAGAAGGGAAATTGGGGAGG + Intronic
989831109 5:45920420-45920442 ACCTCAAACAGATATTTGGGAGG - Intergenic
992104970 5:73442903-73442925 ACTGAGAAGAGACATTTTGGGGG - Intergenic
993260531 5:85652710-85652732 ACATAAAAGAAACATTTGGAAGG - Intergenic
996407622 5:123121733-123121755 AACTATAAAAAATATTTGGGGGG - Intronic
996960496 5:129242511-129242533 ACCCATGAGAGTCATTTGAGAGG + Intergenic
998734108 5:145115131-145115153 AGATTTAAGAGATATTTGGGAGG + Intergenic
999529107 5:152442705-152442727 ATCTATAAGAGCAATTGGGGAGG - Intergenic
1000178043 5:158777538-158777560 AACTGGAGGAGACATTTGGGGGG + Exonic
1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG + Exonic
1003797099 6:9616719-9616741 ACATATAGGACACATTTGAGGGG + Intronic
1006202111 6:32303026-32303048 AGCTATAAGAGAGATTTGGAGGG - Intronic
1007266371 6:40599392-40599414 ACCTCTAGGAGAAATTGGGGTGG + Intergenic
1007375720 6:41455323-41455345 ACCTAGATGAGACAGTGGGGTGG + Intergenic
1013035729 6:106380452-106380474 ACCCATTAGAGTCATTTAGGTGG - Intergenic
1013153597 6:107471365-107471387 ACATATAAAAGACAATTGGCTGG + Intergenic
1015262363 6:131252733-131252755 ATCCATAATAGACATTTGGGAGG + Intronic
1015690397 6:135915540-135915562 ACCTTTAATAGACCTTTTGGGGG + Intronic
1017667288 6:156732697-156732719 GCCAACAACAGACATTTGGGTGG - Intergenic
1020505577 7:8983105-8983127 ACCAAAAACTGACATTTGGGTGG - Intergenic
1022431592 7:30328145-30328167 ACCTGTGACAGACATTTTGGGGG - Intronic
1024270538 7:47638279-47638301 AACTGTAATAGACATTTTGGGGG - Intergenic
1024296943 7:47851947-47851969 AGCTATAGAAGGCATTTGGGGGG + Intronic
1024365451 7:48515449-48515471 TCCTTTTAGGGACATTTGGGTGG + Intronic
1024379915 7:48684926-48684948 GCTTATAAGAAGCATTTGGGGGG + Intergenic
1030575542 7:111281548-111281570 ACCCAACAGAGACACTTGGGAGG + Intronic
1033507225 7:142016958-142016980 AACTATAAGAAACATTTAGTTGG + Intronic
1034831685 7:154313946-154313968 ACCAATAAGAGAACTTTGGCAGG + Intronic
1039673706 8:39634517-39634539 ACCCATGAGACACATTGGGGTGG - Intronic
1043752973 8:83963773-83963795 AACTATAAAAGATATTTGGAAGG + Intergenic
1045011399 8:97961937-97961959 AGCTATAGGTGACATTAGGGAGG - Intronic
1045620548 8:103972569-103972591 AGCTATTGGAGACATTTGGAGGG - Intronic
1045786913 8:105932536-105932558 CCTTATAAGAGACATTTGAGTGG - Intergenic
1047355134 8:124113563-124113585 AGCTATATAAGACATTTTGGGGG - Intronic
1047391486 8:124455484-124455506 AATTCTAAGAGGCATTTGGGAGG - Intronic
1047731482 8:127732518-127732540 ACCTAGAATAGACATTTGCTGGG - Intergenic
1051450072 9:17186926-17186948 TCCTATATGAGACTTTTGGATGG + Intronic
1052810713 9:33056623-33056645 ACCCAGAAGAGACATTTGAAAGG - Intronic
1052841243 9:33292625-33292647 ACCCATAAGAGACATGAGGAAGG - Intronic
1054712065 9:68521633-68521655 ACATGTGAGGGACATTTGGGAGG + Intronic
1055148925 9:72971388-72971410 TCCTTTGATAGACATTTGGGAGG + Intronic
1059663242 9:116422187-116422209 ACCTTTAAGAGAAATTTAGGAGG - Intergenic
1060240693 9:121899898-121899920 ACTCCTAAGAGACATTTGGAAGG - Intronic
1185536642 X:867914-867936 ATCAATAAGAGCCATTTTGGTGG + Intergenic
1187227806 X:17390598-17390620 ACCTAGAAGAGACATTGGGAAGG + Intronic
1188484302 X:30666237-30666259 ACTGATGACAGACATTTGGGTGG - Intronic
1188636148 X:32434175-32434197 AGCTATAAGAAACATTAGGTAGG + Intronic
1189378643 X:40485536-40485558 ATTTCCAAGAGACATTTGGGTGG - Intergenic
1189422189 X:40866149-40866171 AAATATGAGAGACATTTAGGAGG - Intergenic
1192874188 X:75211012-75211034 ATCCAGATGAGACATTTGGGAGG + Intergenic
1194797452 X:98229247-98229269 ACCTATAAAGGTAATTTGGGGGG + Intergenic
1195271122 X:103232057-103232079 GCCTACAAAAGACATTTGAGAGG - Intergenic
1199827317 X:151513547-151513569 GACTCTAGGAGACATTTGGGTGG - Intergenic