ID: 1002412784

View in Genome Browser
Species Human (GRCh38)
Location 5:179096559-179096581
Sequence CCTATCTGGGCCAACATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002412784_1002412789 1 Left 1002412784 5:179096559-179096581 CCCATTATGTTGGCCCAGATAGG No data
Right 1002412789 5:179096583-179096605 GAGCATCTCCCAGCAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002412784 Original CRISPR CCTATCTGGGCCAACATAAT GGG (reversed) Intergenic
No off target data available for this crispr