ID: 1002416072

View in Genome Browser
Species Human (GRCh38)
Location 5:179121594-179121616
Sequence GGCAAGCTCCACAGGGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002416065_1002416072 4 Left 1002416065 5:179121567-179121589 CCATAGACAGAGAGGAGGGGGGC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 135
1002416057_1002416072 26 Left 1002416057 5:179121545-179121567 CCCGCAGAGTCAGGGGAGCTTTC 0: 1
1: 0
2: 5
3: 18
4: 162
Right 1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 135
1002416058_1002416072 25 Left 1002416058 5:179121546-179121568 CCGCAGAGTCAGGGGAGCTTTCC 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002416072 Original CRISPR GGCAAGCTCCACAGGGCGCA GGG Intronic
900313309 1:2045008-2045030 GGCAAGCTCCGCATTGCGCGCGG + Intergenic
900607264 1:3529396-3529418 GCCAAGCCCCACACGGGGCAGGG + Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904744257 1:32701737-32701759 GGCAGGCTGCCCAGGGCCCAAGG - Intronic
905584230 1:39105031-39105053 GGCCGGCTCCACAGGGCGAGCGG - Intronic
906212663 1:44020824-44020846 TGCAAGCACCACAGGCCGCCAGG - Intronic
907427795 1:54391848-54391870 CGCAAGCTCCACGGGGGGCAAGG + Intronic
910705689 1:90127139-90127161 TGCAGGCTCTACAGGGAGCATGG - Intergenic
915479811 1:156176873-156176895 GGCCTTCTCCCCAGGGCGCAGGG - Exonic
923729847 1:236539638-236539660 GGCAAGCTCCACAGGCCAGAGGG - Intronic
1062812419 10:476927-476949 GGCCAGCTCCACCGAGAGCAAGG - Intronic
1064968607 10:21040380-21040402 TGCAAACTGCACAGGGTGCATGG + Intronic
1066177720 10:32926651-32926673 TGCAAGCTCTACAGGAAGCATGG - Intronic
1066758036 10:38730214-38730236 AGCCAGCTCCAGAGGGCGCGAGG + Intergenic
1066963655 10:42242494-42242516 GGTCAGCTCCAGAGGGCGCGAGG - Intergenic
1070148918 10:73793643-73793665 GGCAAGCTCCACAGTGAGACGGG - Exonic
1070201322 10:74208310-74208332 TGCATGCTCCACAGAGCCCATGG - Intronic
1074118784 10:110477867-110477889 GGTAAGCTCCACAGGGCAGGGGG + Intergenic
1074833310 10:117264859-117264881 GCCAAGCTCCACAGAGCAGATGG - Intronic
1075811101 10:125225529-125225551 GGCTAGGTTCACAGGGAGCAAGG - Intergenic
1076342386 10:129758669-129758691 GCCAAGCACCACAGTACGCAGGG - Intronic
1083203746 11:61135065-61135087 GGCACCCGCCACAGGGCGCAGGG + Intronic
1088181899 11:107121944-107121966 GGCAAGCTCCCCCCGGCCCAGGG - Intergenic
1089337414 11:117734673-117734695 TGTAAGCTCCAGAGGGGGCAGGG + Intronic
1089705004 11:120271599-120271621 GGCCAGCTTCACAGGCCCCATGG + Intronic
1090278002 11:125432883-125432905 GGGAAGCCCCAGAGGGCCCAAGG - Exonic
1090809037 11:130220758-130220780 GGCAGGCTCCACGGGGAGCACGG + Intergenic
1091296221 11:134475692-134475714 AGCCACCTCCACAGGGTGCAGGG - Intergenic
1091840619 12:3617859-3617881 GGAAAGCTGCACTGGGAGCATGG - Intronic
1092172640 12:6383579-6383601 GGCAAGCTGCACAGCTCTCAAGG + Intronic
1092464101 12:8712722-8712744 GGCCTGCTCCACAGTGCACACGG - Intronic
1099257292 12:80329643-80329665 GGCAAGCTTCACAGGGCGGGAGG - Intronic
1099861168 12:88227711-88227733 GGGTAGGTCCACAGGGCACATGG - Intergenic
1109073792 13:57806513-57806535 GGCAATCTCCCTAGGGCGGAAGG - Intergenic
1109835503 13:67851416-67851438 GGCAAGGTCAAAAGGGCACATGG - Intergenic
1110292043 13:73818805-73818827 GGCAGGCGCCACAGGGCTGATGG + Intronic
1110790598 13:79582457-79582479 GGCATGATCCACAGGGAGGAAGG - Intergenic
1122231325 14:100307449-100307471 GGGACGCTCCACAGGGACCAGGG - Intergenic
1124250553 15:28104225-28104247 GGCCAGCTCCACAGGGTGGGAGG - Intergenic
1125796776 15:42409223-42409245 GGCAAGCTCCTCTGGGCCAAGGG - Intronic
1128145144 15:65328877-65328899 GGCAGGCTCCAGAGGGTGGACGG - Exonic
1131154263 15:90065210-90065232 GGGAAGCTCCGCTGGGCGCTGGG + Intronic
1131212553 15:90510383-90510405 GGCCAGCTTCCCAGGGCACAGGG - Intergenic
1136531865 16:30875304-30875326 GGCAACCTCAGCAGTGCGCAGGG - Intronic
1136843144 16:33555058-33555080 GGCCAGCTCCAGAGGGCGCGAGG - Intergenic
1137716930 16:50603811-50603833 GGCCAGCTCCTCCGGGCACAGGG - Intronic
1137839530 16:51627166-51627188 TGCAAGCTGCACAGGAAGCATGG - Intergenic
1138084221 16:54119127-54119149 GGCAGTTTCCACAGGGTGCATGG - Exonic
1139966741 16:70749916-70749938 GGCAACCTCAACAGGGGGCCTGG + Intronic
1140851251 16:78936603-78936625 GGCAAGGTCCACAGGCTGGATGG + Intronic
1141630174 16:85283365-85283387 GCCAAGATGCTCAGGGCGCAGGG - Intergenic
1142234288 16:88914682-88914704 GGCACTGTCCACAGGGTGCAGGG - Intronic
1203153309 16_KI270728v1_random:1855356-1855378 GGCCAGCTCCAGAGGGCGCGAGG - Intergenic
1147761189 17:42798550-42798572 GGCAAGCTCCGCCTGCCGCATGG + Exonic
1148384810 17:47226712-47226734 GGCATGCTCCACAGTCCTCAGGG + Intergenic
1150226773 17:63528703-63528725 GGCAGGATCCTCAGGGGGCAGGG - Intronic
1152785682 17:82246755-82246777 TCCCATCTCCACAGGGCGCAAGG + Intronic
1153816482 18:8794589-8794611 GGCAAGCTTCACTGGCCTCAGGG - Intronic
1160478613 18:79217604-79217626 AGCAAGCTACACTGGGCGAAAGG + Intronic
1160802549 19:977030-977052 CGCAAGGTCCACAGGGCCGAGGG + Intergenic
1161745403 19:6056564-6056586 GGTAAAGTCCACAGGGCACAGGG + Intronic
1162029787 19:7912444-7912466 GGCCAGCCCCACAGGGGGCCAGG + Exonic
1162578435 19:11513113-11513135 GGCCAGCTCCACAGGGTCCTGGG + Exonic
1163433904 19:17283784-17283806 GGCAAGCTCTACAGGTGGCAGGG + Exonic
1163469822 19:17489602-17489624 GGGAAGACCCACAGGGCACAAGG - Intronic
1165628709 19:37292174-37292196 AGAAAGATCCCCAGGGCGCAAGG + Intergenic
1165629792 19:37297225-37297247 AGAAAGATCCCCAGGGCGCAAGG + Intergenic
1167985022 19:53307353-53307375 GGCAGGCTGCACAGGAAGCATGG - Intergenic
925485832 2:4329627-4329649 GGCAAGTTCCTGAGGGCGCTGGG - Intergenic
925894759 2:8462853-8462875 GGAAAGCCCCACAGGCCTCACGG + Intergenic
926350680 2:11991394-11991416 TGCAAGCTTCACAGGAAGCATGG - Intergenic
932060599 2:68494332-68494354 GGCAAGCTTTACAGGAAGCATGG + Intronic
934321352 2:91974656-91974678 GGCCAGCTCCAGAGGGCGCGAGG + Intergenic
935194557 2:100804744-100804766 GGCAACTTCCTCAGGCCGCATGG + Intergenic
939055601 2:137360912-137360934 GTTAAGCTACACAGGGCTCAGGG - Intronic
942739032 2:179152310-179152332 GGCAAGCACCACAGAGAGAAAGG + Intronic
943882020 2:193157942-193157964 GGCAGGCTTTACAGGGAGCAGGG - Intergenic
946973777 2:225124643-225124665 GCTAAGCTCCACAGTGAGCAAGG - Intergenic
948245534 2:236481070-236481092 GGCAGGCTCCACAGGTCCCCTGG - Intronic
948783449 2:240338938-240338960 TGCAGGCTTCACAGGGAGCAAGG - Intergenic
1169376955 20:5073899-5073921 TGCAAGCTCTACAGGAAGCATGG + Intronic
1169574370 20:6941845-6941867 GGCAGGCTGCACAGGGGGCAAGG + Intergenic
1169977738 20:11349298-11349320 TGCAAGCTCTACAGGAAGCATGG - Intergenic
1171015789 20:21540731-21540753 GGGAATCTCCACAGGACTCAAGG + Intergenic
1171239051 20:23550639-23550661 GGCAGACTCCACATGGCGCAGGG + Intergenic
1171500005 20:25585764-25585786 GCCAAGCTCCGCAGCGCGCAGGG - Intergenic
1172525809 20:35600194-35600216 GGAAATCTTCACAGGGCGCCAGG + Intergenic
1174657314 20:52182363-52182385 GGCAAGATCCAATGGTCGCAGGG + Intronic
1175047664 20:56122465-56122487 GGGAAGCACCCCAGGGCGCTGGG - Intergenic
1175421320 20:58835938-58835960 GGAAAGCTCCACAGGCCGCTGGG + Intergenic
1175646617 20:60679613-60679635 GGCTACCTCCACAGAGGGCAGGG + Intergenic
1176043095 20:63076405-63076427 TGCAAGCTGCACAGGAAGCATGG + Intergenic
1177267880 21:18808136-18808158 TGCAAGTTCCACAGAGAGCATGG + Intergenic
1177511468 21:22092304-22092326 GGCATGCTCCACAGAGAGAAAGG - Intergenic
1178496581 21:33091188-33091210 GGCCAGTTCCACAGGCCACATGG + Intergenic
1178571819 21:33745282-33745304 GGGAAACTCCACAGGTCACATGG + Intronic
1180309600 22:11158625-11158647 GGCCAGCTCCAGAGGGCGCGAGG + Intergenic
1180548077 22:16520435-16520457 GGCCAGCTCCAGAGGGCGCGAGG + Intergenic
1180975234 22:19844475-19844497 GGCCAGCTCCACAGTCAGCAGGG + Intronic
1182211376 22:28679927-28679949 GGCCAGCTCCAGAGGGCGCGAGG - Intergenic
1182440716 22:30362376-30362398 GGAAAGCTCCCCAGGGCCCCAGG - Intronic
1183728898 22:39605947-39605969 GGCAAGGTCCAGAGGCTGCAGGG + Intronic
1184227037 22:43135019-43135041 GGCTAGGGCCACAGGGCTCAAGG + Intronic
950465966 3:13153828-13153850 GCCAAGCTCCACTGGGCTCCTGG - Intergenic
950940105 3:16884134-16884156 GGCAATCTCGACAGGGAGCTAGG + Intronic
959303319 3:104630053-104630075 TGCAGGCTGCACAGGGAGCATGG + Intergenic
965397124 3:168173472-168173494 TGCAAGCTCTACAGGAAGCATGG + Intergenic
966135381 3:176692380-176692402 GACAAGCTGCAGAGGGCTCAGGG - Intergenic
968136993 3:196226965-196226987 GGCAAGTTCCACAGGGCCCAGGG - Exonic
968965114 4:3765821-3765843 GGCCAGCTCCCCAGGGCCCGCGG + Intergenic
971475109 4:27065462-27065484 GGCAAGTTGCACAGGGCTCCAGG - Intergenic
973619829 4:52715143-52715165 AGCAGGCTGCACAGGGAGCATGG - Intergenic
975112632 4:70644054-70644076 TGGTAGCTCCACAGGGCCCAAGG + Exonic
985853392 5:2405812-2405834 TGCAAGCTGTACAGGGAGCATGG + Intergenic
985903378 5:2814294-2814316 GGCAGGGTCCGCAGGGCCCAAGG + Intergenic
985972060 5:3386123-3386145 GGCCAGCTCCAGAGTGCGCAGGG + Intergenic
986236532 5:5915691-5915713 GGCCAACACCACAGGGCACACGG - Intergenic
990955381 5:61333572-61333594 GGCGAGCTCCACTGGCCGCCCGG + Intronic
997200028 5:132004314-132004336 TCCATGCTCCACAGGGCACAAGG - Intronic
1001734052 5:173984287-173984309 GGCATGCTCCACAGGTCCCTGGG + Intronic
1002416072 5:179121594-179121616 GGCAAGCTCCACAGGGCGCAGGG + Intronic
1004301310 6:14460504-14460526 TGCAGGCTGCACAGGGAGCATGG - Intergenic
1005963251 6:30708244-30708266 GGCAAGGTCCATAGGCCTCAAGG + Exonic
1006147645 6:31968995-31969017 AGCAATCTCCTCAGGCCGCAGGG - Exonic
1007964219 6:45988765-45988787 GGCCAGCACCACAAAGCGCAAGG - Intronic
1008447646 6:51611391-51611413 TGCAAGGTCCAGAGGGCTCAGGG + Intergenic
1010060405 6:71615994-71616016 TGCAAGCTCTACAGGAAGCATGG + Intergenic
1012875385 6:104720512-104720534 CGCAGGTTCCACAGGGCCCACGG - Intergenic
1013160848 6:107543283-107543305 GGCAAGCTCCCCAGTGGTCATGG + Intronic
1015894111 6:137999872-137999894 TGCAAGCTGCACAGGAAGCATGG + Intergenic
1016461163 6:144281474-144281496 GGCCAGCACCCCAGGGCACAGGG + Intergenic
1017025505 6:150177503-150177525 TGGAAGCTCCACAGGCCCCAAGG - Intronic
1018433448 6:163741717-163741739 GACAAGCTCCAGAGGGAGCTTGG - Intergenic
1020189856 7:5987183-5987205 GGCCAGCTCCCCAGGGGACAGGG - Exonic
1021678600 7:23106222-23106244 GGCGCGATCCACAGGGCGCGGGG - Intronic
1021982237 7:26066084-26066106 GGGAAGGTCCACTGGGCGTATGG - Intergenic
1023497016 7:40808472-40808494 GGCAATGTCCCCAGGGAGCATGG - Intronic
1029177169 7:98673016-98673038 TGCAAGCTGCACAGGAAGCATGG + Intergenic
1037060089 8:14497217-14497239 TGCAAGCTGTACAGGGAGCATGG + Intronic
1043384361 8:79733296-79733318 TGCAAGCTGCACAGGAAGCATGG + Intergenic
1046285948 8:112092766-112092788 GGCAAGGTGCACAGGAGGCAGGG + Intergenic
1047251399 8:123184119-123184141 GACAAGCTCTACAGGGCACTTGG - Intronic
1047553422 8:125901860-125901882 GGCAAGATCCACAGAGAACATGG - Intergenic
1047647770 8:126886799-126886821 TGCAGGCTCTACAGGGAGCATGG - Intergenic
1048229305 8:132621291-132621313 CTCAAGCTCCAGAGGGCACAGGG + Intronic
1048993313 8:139774083-139774105 GACAAGCTCCCCAGGCCACATGG + Intronic
1052768437 9:32665608-32665630 TGCAAGCTGCACAGGAAGCATGG + Intergenic
1060404261 9:123365462-123365484 GGCAAGTTCCACTAGGGGCAGGG - Intronic
1060516631 9:124270078-124270100 GGCAAGCCCCACAGACAGCATGG - Intronic
1060883214 9:127133215-127133237 GGCAGCCTCCCCAGGGTGCACGG - Intronic
1186926800 X:14342620-14342642 GGAAAGCTCCAGAAGGCTCAAGG - Intergenic
1197885028 X:131209463-131209485 TGCAAGCTCCATGGGGGGCAAGG - Intergenic
1200918807 Y:8594906-8594928 GGCAAGCTCCACAACGAGAATGG - Intergenic
1201188839 Y:11429780-11429802 GGCCAGCTCCAGAGGGCTCGAGG + Intergenic