ID: 1002416339

View in Genome Browser
Species Human (GRCh38)
Location 5:179122773-179122795
Sequence ACTGCAGGGGGAGAGTCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002416334_1002416339 -7 Left 1002416334 5:179122757-179122779 CCACAGGTTACTGAGCACTGCAG 0: 1
1: 0
2: 5
3: 21
4: 187
Right 1002416339 5:179122773-179122795 ACTGCAGGGGGAGAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1002416330_1002416339 12 Left 1002416330 5:179122738-179122760 CCGCTCCTGGGTGCCGTTGCCAC 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1002416339 5:179122773-179122795 ACTGCAGGGGGAGAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1002416332_1002416339 7 Left 1002416332 5:179122743-179122765 CCTGGGTGCCGTTGCCACAGGTT 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1002416339 5:179122773-179122795 ACTGCAGGGGGAGAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1002416333_1002416339 -1 Left 1002416333 5:179122751-179122773 CCGTTGCCACAGGTTACTGAGCA 0: 1
1: 0
2: 2
3: 15
4: 182
Right 1002416339 5:179122773-179122795 ACTGCAGGGGGAGAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002416339 Original CRISPR ACTGCAGGGGGAGAGTCGCC AGG Exonic