ID: 1002416657

View in Genome Browser
Species Human (GRCh38)
Location 5:179124357-179124379
Sequence GCTGGGAGGAAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 1, 2: 3, 3: 105, 4: 889}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002416657 Original CRISPR GCTGGGAGGAAGAATGAGGA TGG (reversed) Intronic
900596249 1:3481467-3481489 GCTGGGAGGAAAAACTGGGAGGG - Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
902192048 1:14770603-14770625 CCTGGGAGGAAGAGTGGGAATGG + Intronic
902449105 1:16485379-16485401 GCTGGGAGGAAGAAATGGGATGG + Intergenic
902468497 1:16632085-16632107 GCTGGGAGGGAGAAATGGGATGG + Intergenic
902505639 1:16937902-16937924 GCTGGGAGGAAGAAATGGGATGG - Intronic
902619481 1:17642564-17642586 GGTGGGAGCAGGAATGGGGAGGG + Intronic
902652261 1:17844559-17844581 GCTGGGAGGAGGAGGGAGGAGGG + Intergenic
902786528 1:18735906-18735928 GGTGGGAGAAGGAATGGGGACGG - Exonic
902900422 1:19511595-19511617 GCAGGGTGGAACAGTGAGGAAGG + Intergenic
903140100 1:21334289-21334311 GCTGGGAGCCAGAGAGAGGAGGG - Intronic
903154626 1:21435562-21435584 GCTGTGAGGAAGAAATGGGATGG - Intergenic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903759915 1:25690648-25690670 GCTGGGTGGCAGAAAGAGCATGG + Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904490108 1:30853429-30853451 GATGGGAGAAATAATGAAGAAGG - Intergenic
904764077 1:32828888-32828910 GCTACGAGGAAGACTGAGGTGGG + Intronic
904896221 1:33820396-33820418 GCTGGGAGGAAGACAGGGGCTGG - Intronic
905081918 1:35330249-35330271 GGAGGGAGGAAGGATAAGGAAGG + Intronic
905384879 1:37595706-37595728 GCTTGGAGGAAGTATAGGGAAGG - Intronic
905508401 1:38498942-38498964 GCTGGGAGAAGGGAAGAGGAAGG + Intergenic
905761966 1:40566365-40566387 GCGGGGAGGGAGGATGAGTAGGG + Intergenic
905869282 1:41394039-41394061 GCTGGGAGGCAGAAAGGTGAGGG - Intergenic
906214935 1:44033213-44033235 GCTGGAAGGGAGAAGGAGGGAGG - Intergenic
906717472 1:47980793-47980815 TCTAGGAGATAGAATGAGGAGGG - Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906825398 1:48974057-48974079 GCTGTGAGAGAAAATGAGGAGGG + Intronic
906927570 1:50135499-50135521 GCTGGGAGGATGGCAGAGGAGGG - Intronic
907647226 1:56256185-56256207 GTTGGGAGGAAGAATGAGAGTGG + Intergenic
908135986 1:61133225-61133247 GCTGTGTGGAGGAATGAGGAAGG + Intronic
909800626 1:79803016-79803038 GCAGGGTGAAAGAATGAGGATGG - Intergenic
910194110 1:84622860-84622882 CCTGTGTGGAAGCATGAGGAAGG + Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
911366096 1:96939206-96939228 GATGAGTGGAAAAATGAGGATGG - Intergenic
911504620 1:98733309-98733331 GCTAGGAGGCAGAGTCAGGAGGG - Intronic
912588120 1:110785561-110785583 GCTGGAGGGTAGAATGAGGAGGG + Intergenic
912718786 1:112002589-112002611 GGTGGGAAGAAGAATGATGGGGG - Intergenic
913961503 1:143341115-143341137 ACTGGGAGGGAGAATGAAGGGGG - Intergenic
914055856 1:144166688-144166710 ACTGGGAGGGAGAATGAAGGGGG - Intergenic
914123290 1:144799674-144799696 ACTGGGAGGGAGAATGAAGGGGG + Intergenic
914689792 1:150015685-150015707 GCATGGAGGAAGAAGGAGGATGG - Intergenic
914786340 1:150835370-150835392 GATGGGAGGAGGAATGCTGAAGG + Intronic
914912585 1:151799740-151799762 GCTTGGAGGAACAGGGAGGAGGG - Intergenic
914951814 1:152122351-152122373 GGTGGGAGTGAGGATGAGGAAGG + Intergenic
915502688 1:156330226-156330248 CCTGGAAGGATGAAAGAGGAGGG - Intronic
915725995 1:158018147-158018169 GCTGAGAGGAAGAATTGGGGGGG + Intronic
915734716 1:158077525-158077547 CCAGGGAGGAAGGATGAGGCAGG - Intronic
915949542 1:160179330-160179352 GCAGGGAGGAAGTATCAAGATGG - Intronic
915981763 1:160424794-160424816 GAAGGAAGGAAGAATGAGGGAGG + Intronic
916169322 1:161988727-161988749 GTCTGCAGGAAGAATGAGGAGGG - Intronic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916361490 1:163975186-163975208 GGTGGGAGGAAGAAGGAGTGAGG - Intergenic
916686244 1:167149943-167149965 TCTGGCAGGAAGAAAAAGGAAGG - Intergenic
917223810 1:172760475-172760497 GCTGTGAACAAGAAGGAGGATGG + Intergenic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917344103 1:174010740-174010762 GCTGTGAGGAAGGTAGAGGAAGG - Intronic
917469576 1:175314938-175314960 GAAGGAGGGAAGAATGAGGAAGG + Intergenic
917517453 1:175719808-175719830 GCTGGTTTGAAGAATGGGGAGGG - Intronic
917626376 1:176850678-176850700 CCTGGGAGGGAGAATGAGCCAGG + Intergenic
917731477 1:177879283-177879305 GTTTTGAGGAAGAATGGGGAGGG + Intergenic
918357214 1:183716491-183716513 GCTGGGAGGAGAAAAGAGCATGG + Intronic
918405282 1:184206278-184206300 GTTGGGAGGAGGAAAGGGGAGGG - Intergenic
918761867 1:188420595-188420617 GAAGGAAGGAAGAAGGAGGAAGG - Intergenic
919763759 1:201113888-201113910 GCTGGGAGTGAGAATAAGAAAGG + Intergenic
920070028 1:203296129-203296151 CCTGGGAGTGAGGATGAGGAGGG + Intergenic
920806925 1:209243448-209243470 GCTTGCAAGAAGGATGAGGAAGG + Intergenic
920944443 1:210515321-210515343 GCTGGGAAGAGGAAAGATGAAGG - Intronic
920969589 1:210731836-210731858 GCTGGGAGAAGGAATTAGGCAGG - Intronic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921190235 1:212701186-212701208 GCGGGGAGGAAGACGGAGGGTGG + Intergenic
921572868 1:216799460-216799482 GCAGGGAGGCACAATGAAGAGGG + Intronic
922113218 1:222583243-222583265 GCTGTGAGGAGGAATGGGGAAGG + Intronic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922224531 1:223633886-223633908 GCAGGTAGAAAGAAAGAGGAAGG + Intronic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923728602 1:236529163-236529185 GCTATGAGGAAGAGTGAGGTGGG + Intronic
923993268 1:239463831-239463853 GCGGGGAGAAAAAATGGGGAGGG - Intronic
924088955 1:240483360-240483382 GCTGGGAGGAACTCTGTGGATGG - Intergenic
924324832 1:242885213-242885235 GCAGGGAGGAAAAGGGAGGAGGG + Intergenic
924514480 1:244754593-244754615 GGTGGGTGGATGAATGAGGAAGG + Intergenic
924531382 1:244896784-244896806 GCTGAGAGGAAACATGAGCAAGG + Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063259646 10:4372129-4372151 GCTGGGAGGTGGTATGAGGAAGG + Intergenic
1063535433 10:6878113-6878135 ACCCGGAGGAAGAAAGAGGAGGG - Intergenic
1064890619 10:20167897-20167919 GATGTGAGGAAGAATGAATAGGG - Intronic
1065246979 10:23768322-23768344 ACTGGGAGGAAACATGAGCAGGG + Intronic
1065343988 10:24731188-24731210 GCTGGAAGGAGGCATGAGAATGG - Intergenic
1065492432 10:26295182-26295204 GCTGTAATGAAGAATGGGGATGG + Intronic
1066364342 10:34762403-34762425 GATGGGAGGAAGGCTGAGGTGGG - Intronic
1066566352 10:36725607-36725629 GCTGTGAGAAGGAAGGAGGAAGG - Intergenic
1067156566 10:43786007-43786029 GATGGGAGGAAGAAGATGGACGG - Intergenic
1067183354 10:44006819-44006841 GCTGGGAGAAAGAGAGAGGCTGG - Intergenic
1067222194 10:44352413-44352435 TTTGGGAGAAAGACTGAGGAGGG + Intergenic
1067557839 10:47284944-47284966 GGAGGGAGGAAGGAGGAGGAGGG + Intergenic
1067557853 10:47284976-47284998 GGAGGGAGGAAGGAGGAGGAGGG + Intergenic
1067557867 10:47285008-47285030 GGAGGGAGGAAGGAGGAGGAGGG + Intergenic
1067786532 10:49253503-49253525 GGTGGGAGGAAGGAGGAGGGGGG + Intergenic
1067786589 10:49254740-49254762 GGTGGGAGGAAGGAAGAGGGGGG + Intergenic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068125390 10:52835569-52835591 GCTGGGAAGGATAATGATGAGGG + Intergenic
1068533136 10:58210967-58210989 GATGGGAGGAAGATGGTGGATGG - Intronic
1068842377 10:61629955-61629977 GCTGGGAGGGAGACTGAGGCCGG + Intergenic
1069391977 10:67945914-67945936 GAAGGAAGGAAGAAGGAGGAAGG + Intronic
1069622775 10:69848002-69848024 GCTGGGAAGAGGAAGGAGGTGGG - Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069883548 10:71609159-71609181 GCCTGGAGGAAGAAAGAGGTAGG + Intronic
1070342929 10:75514267-75514289 GGAGGAAGGAAGAAGGAGGAGGG - Intronic
1070572331 10:77649871-77649893 GCTGGGAGCAGAAAGGAGGATGG - Intergenic
1070836857 10:79452971-79452993 GCTGGGGGGAAGAAGAAGGCTGG - Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071299380 10:84245072-84245094 GCAGTGAGGGAGAGTGAGGATGG + Exonic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1072012121 10:91311342-91311364 ACTGGGAGAAAATATGAGGAAGG + Intergenic
1072226326 10:93373265-93373287 GCTGGGAGGCAGACTGTGGCTGG + Intronic
1072564607 10:96607184-96607206 GCAGAGAGGGAGAGTGAGGATGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1073267141 10:102234568-102234590 GCTGGGAAGATGAGGGAGGAAGG + Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1074296096 10:112191064-112191086 TCTAGGAGGGAGAGTGAGGAGGG + Intronic
1074329686 10:112492949-112492971 AATGGGAGTACGAATGAGGACGG - Intronic
1074767952 10:116714412-116714434 GCTTGGGGGTAGAATGAGAAAGG - Intronic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1074963112 10:118465527-118465549 GCAGGGAGGAAAATTGAGGCTGG - Intergenic
1075144121 10:119868895-119868917 GCTGGGATGGAGTATGAGGAGGG + Intronic
1075270774 10:121048289-121048311 GCAGGGAAGGAGATTGAGGAAGG + Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075518970 10:123132785-123132807 CCTGGGAAGACGAATGAGGCAGG + Intergenic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075648083 10:124109502-124109524 GCTGGGAGGCAGGATGAAGAGGG + Intergenic
1075982245 10:126750071-126750093 CCTGGGGGGAAGAGTGAGGGGGG - Intergenic
1076058655 10:127395880-127395902 GCCGGGAGGAAGATGTAGGAAGG + Intronic
1076236808 10:128869871-128869893 GCTGGAAGGAAGGAATAGGATGG + Intergenic
1076776463 10:132700576-132700598 GCTGGAGGGAGGAAGGAGGAGGG + Intronic
1077254311 11:1573543-1573565 GCTGGCAGGAAGACTGAGTATGG - Intergenic
1077483864 11:2830032-2830054 GGAGGGAGGAGGAAGGAGGAGGG + Intronic
1077898096 11:6469169-6469191 GCTGGGAGGAAGAGTGGGAGTGG + Intronic
1077932577 11:6750168-6750190 GCTGGGTGGAGGAATCTGGAGGG - Intergenic
1077936973 11:6798418-6798440 GCTGTGAGGAACTAGGAGGAAGG - Intergenic
1078283151 11:9923078-9923100 CGAGGGAGGAAGAAAGAGGAGGG - Intronic
1078329534 11:10408228-10408250 TGTGGGAGGAAGAAGGAGGGAGG + Intronic
1078597993 11:12705124-12705146 GCTGGAAGGAGGGATGAGGCAGG + Intronic
1079051522 11:17164860-17164882 TCTTGGAGGAATAATGAGGATGG - Intronic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080309618 11:30874502-30874524 GCAGGGAGGAAGAGGGAGGAGGG + Intronic
1080541746 11:33272814-33272836 GAGGGGAGGAAGAAAGAGGGAGG - Intronic
1080594070 11:33753185-33753207 GCAGGGAGGAAGGATGAAAAAGG - Intronic
1080856475 11:36116085-36116107 GCTGGGAGGAAATGTGAGAAAGG + Intronic
1080943254 11:36943059-36943081 GCTGGAAGGCAGAGTGATGAAGG + Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081700087 11:45147134-45147156 GCTGGGAGGAAGGAGGCGGAGGG - Intronic
1082897280 11:58205277-58205299 TCAGGGAGGAAGAATGGGGATGG - Intergenic
1082987892 11:59183685-59183707 ACTGGGAGGAGGAATGAAGGAGG + Intronic
1083281056 11:61627578-61627600 GCTTGTTAGAAGAATGAGGATGG - Intergenic
1083308628 11:61773424-61773446 GGAGGGAGTAGGAATGAGGAGGG + Intronic
1083331903 11:61902624-61902646 GCTGAGAGGATGCATGGGGAGGG + Intronic
1083680483 11:64349470-64349492 GCTGAGGGGAAGAATGAGGGAGG + Intronic
1084216050 11:67647460-67647482 GCTGGGAGGAGCAAGCAGGAGGG - Intronic
1084750586 11:71202261-71202283 CCTGAGGGGAGGAATGAGGAGGG - Intronic
1084767972 11:71324838-71324860 GTGGGGAGCAAGAATGAGGCAGG + Intergenic
1084772842 11:71355437-71355459 GCTGGGGAGAAGGAGGAGGAGGG - Intergenic
1085046770 11:73358091-73358113 GCTGTGAGCAAGAATGGGGCAGG + Intronic
1085265555 11:75236016-75236038 GTTGGGGGGAAGACTGAGGTGGG + Intergenic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1085401475 11:76238472-76238494 GCTGGGAAGAAGAATATGAAAGG + Intergenic
1087251215 11:95902574-95902596 AATGGGAGGTAGAATGAGAAGGG - Intronic
1087732082 11:101790264-101790286 GGAGGGAGGAAGAAGGATGATGG + Intronic
1087734085 11:101811881-101811903 GCTGGGAGGGATAAAAAGGATGG - Intronic
1088127494 11:106446513-106446535 GCTGCCAGGAAGATTGTGGAAGG + Intergenic
1088677486 11:112209248-112209270 GCTGAGAGGAGGAAAGGGGAAGG - Intronic
1088976851 11:114823375-114823397 GACGGGATGAAGACTGAGGAAGG - Intergenic
1089128287 11:116192836-116192858 GCTGTGAGGAACACTGAGGGAGG - Intergenic
1089135542 11:116246227-116246249 GCTGGTGGGAGGAGTGAGGATGG - Intergenic
1089597846 11:119593040-119593062 GCTGGAAAGTAGAGTGAGGAAGG + Intergenic
1089747501 11:120627552-120627574 GCTGGGAGGTGGAATGAGCCCGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090094169 11:123727300-123727322 GATGGGAGGAGAAAAGAGGAGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090465759 11:126931682-126931704 GCTGTAAGGAAGAATGAATATGG - Intronic
1091176996 11:133568686-133568708 GCTGGGAGGAAAATGGAGGATGG - Intergenic
1091217002 11:133908224-133908246 GCTGGAAGGAAGAAAGATGCAGG + Intergenic
1091319128 11:134637359-134637381 GCCCTGAGGAAGAATGAGGGAGG + Intergenic
1091443233 12:527665-527687 GCTGGGAGGGAGCATGAGATGGG + Intronic
1092279849 12:7090753-7090775 GCTGTGAGGAGGAAGGAAGAGGG - Intronic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092735778 12:11581025-11581047 GCTGCTAGGAAGACTGAGGTGGG + Intergenic
1092754808 12:11753339-11753361 GCTGGGTGGCAGTATGAGAAAGG - Intronic
1092918254 12:13207672-13207694 GCTGGGTGGGAAACTGAGGAAGG - Intronic
1093945279 12:25100594-25100616 GCTGGAAGGAGGAATAAGGCTGG + Intronic
1094058086 12:26286463-26286485 GCTGGGAGGCAGCAGGAGAAAGG + Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094633254 12:32198747-32198769 GCTGGCAAGAAGGATGTGGAAGG - Intronic
1095149238 12:38771351-38771373 GCTAGGAGGGAGACTGAGGTGGG + Intronic
1095295953 12:40527733-40527755 GCTGTGAGGTAGAAAGAAGAGGG - Intronic
1095864487 12:46956631-46956653 GGTGGGGGGAAGAATGCGGAAGG + Intergenic
1096161865 12:49385668-49385690 GCTGAGAGTGAGGATGAGGAGGG + Intronic
1096271268 12:50167640-50167662 GCTGGATGGAAGAGTGAGGGAGG - Intergenic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096793915 12:54062073-54062095 GGAGGGAGGGAGAAAGAGGAGGG - Intergenic
1096841948 12:54385199-54385221 GCATGGGGGAAGACTGAGGAAGG - Intronic
1096872559 12:54602729-54602751 GGTGGCAGGAAGACTCAGGAGGG + Intergenic
1097107190 12:56632783-56632805 GCTCTGAGGAAGGATGAGGTTGG + Intronic
1097191797 12:57222832-57222854 GATGGGAGGGGGAATGAGGGGGG + Intronic
1097268055 12:57756908-57756930 CCCTGGAGGAAGAGTGAGGAGGG - Exonic
1097322181 12:58238077-58238099 GTTGGGGGGAATAAAGAGGAAGG + Intergenic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098876039 12:75867406-75867428 GCTGGGAGGAAGAGTGAGGAGGG - Intergenic
1099146882 12:79057776-79057798 GCAGGAAGGAGGGATGAGGAAGG - Intronic
1100405834 12:94272338-94272360 GCTGGGATGGGGAATGAGGCTGG - Intronic
1100930712 12:99606916-99606938 GCTGGGGTGAACAATGGGGAGGG - Intronic
1100998923 12:100335188-100335210 GATAGGAGGAAGAAAAAGGAAGG - Intronic
1101427681 12:104601119-104601141 GGAGGGAGGAGGAAGGAGGAAGG - Intronic
1101960429 12:109245361-109245383 GTTGGGAGGAAGAATGAGCTGGG + Intronic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102480825 12:113221901-113221923 GGAGGGAGGAAGAAGGAGGCAGG - Intronic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102960704 12:117091665-117091687 GCTGGGAGGAAGAGGCAGGAGGG - Intronic
1102985581 12:117275493-117275515 GCTGGGAGGAGGAGGGAGAAGGG + Intronic
1104026210 12:125028317-125028339 GGTGGGAGGAGGAATGAAGCGGG - Exonic
1104082139 12:125438661-125438683 GAAGGAAGGAAGAAGGAGGAAGG - Intronic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104457648 12:128928730-128928752 GCTGCTAGGAAGACTGAGGCTGG - Intronic
1106171618 13:27293471-27293493 GAGGCGGGGAAGAATGAGGAGGG - Intergenic
1106389639 13:29322600-29322622 GCTGTGAGGAAGAATGAAGCGGG + Intronic
1106470696 13:30051727-30051749 TCTAGGAGGAAGAAGGAGGAAGG + Intergenic
1107132845 13:36914562-36914584 GCTGAGAGGAGGAGTGAGGAAGG - Intronic
1107446581 13:40474851-40474873 GGTGGGAGGAAGAACAAGGAAGG - Intergenic
1107824917 13:44320119-44320141 GCTGCATGGGAGAATGAGGAGGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108519628 13:51234655-51234677 GATGGAAGGAAGGAGGAGGAAGG + Intronic
1108608244 13:52061707-52061729 GCTGGGAGAGAGAATTGGGAGGG - Intronic
1108628161 13:52253082-52253104 GCTGGGGGGAACAAAAAGGAGGG + Intergenic
1108657899 13:52553367-52553389 GCTGGGGGGAACAAAAAGGAGGG - Intergenic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1109082284 13:57919575-57919597 GCTGGGAGAAAGAGTGCTGAGGG - Intergenic
1109217457 13:59605772-59605794 TGAGGAAGGAAGAATGAGGACGG + Intergenic
1109217460 13:59605790-59605812 GACGGAAGGAAGAATGAGGAAGG + Intergenic
1111604586 13:90520588-90520610 GCTAGGAGGCAGTAGGAGGAGGG - Intergenic
1111691038 13:91563790-91563812 GCTGGCAGCAACATTGAGGAAGG - Intronic
1111691048 13:91563848-91563870 GCTGGCAGCAACATTGAGGAAGG - Intronic
1111721430 13:91950344-91950366 GCTGGGAGGGAGGAGGAGGGAGG - Intronic
1111951852 13:94713771-94713793 GCCGGGAGGAAGAAGGCGGCGGG + Intergenic
1112062281 13:95753078-95753100 GGAGGGAAGAAGAAGGAGGATGG - Intronic
1112484252 13:99805565-99805587 GCTGGGAGGAAGGAGGGGGTGGG + Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112688576 13:101862233-101862255 GATGGGAGGATGAAAAAGGAAGG - Intronic
1113538854 13:111091091-111091113 GCTACCAGGGAGAATGAGGAAGG + Intergenic
1113595262 13:111527164-111527186 GCTGTGAGGAAGCGTGAGGAAGG + Intergenic
1113758477 13:112831183-112831205 GCTGGGAAGGAGGATGAGGCAGG + Intronic
1113913302 13:113854924-113854946 GCGGGGAGGAGGAAGGAAGAGGG + Intronic
1114269880 14:21094151-21094173 GGAGGGAGGGAGAATGAGGGGGG - Intronic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1117903052 14:60555212-60555234 GCTGGTGGCAAAAATGAGGATGG + Intergenic
1118114288 14:62757816-62757838 GATGGGAGGAAAAGTGAAGATGG + Intronic
1118123117 14:62868215-62868237 CCTGGTGGGAAGAATGTGGAAGG - Intronic
1118285376 14:64465735-64465757 GCTGGGAGTAAGAACGCGGGAGG + Intronic
1118766284 14:68911818-68911840 GCTGGGAGGAAGGACCAGGAGGG - Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119417478 14:74482880-74482902 GCTGGGAGGAGGGAGGAGGGAGG + Intronic
1119569477 14:75657595-75657617 GAAGGGAGGAAGAATGAAGCAGG + Intronic
1120170114 14:81239664-81239686 GGTAGGAGGAAGGAAGAGGAAGG - Intergenic
1120262398 14:82202570-82202592 GCAGGTAGGAAGAATATGGAAGG - Intergenic
1120596249 14:86441185-86441207 GGTGGGTGGAAGTATGAAGATGG - Intergenic
1120689930 14:87581151-87581173 GCTGGGAGTAGCAATAAGGAAGG + Intergenic
1120733422 14:88027607-88027629 CCAGGGAGCAGGAATGAGGAAGG + Intergenic
1120838625 14:89063320-89063342 ACTGGGAGGAAGAATGAGCTGGG + Intergenic
1120856399 14:89216509-89216531 GCAGGGAGGGAGACTGAGGCAGG - Intronic
1121180611 14:91925959-91925981 GCTGGGAGACTGAGTGAGGAAGG + Intronic
1121204452 14:92150537-92150559 GCTGGTAGGAAGGCTGAGGCAGG - Intronic
1121212807 14:92221707-92221729 TCTGGGATGGAGCATGAGGAGGG - Intergenic
1122626890 14:103089524-103089546 CCAGGGAGGCAGAATGAGGCTGG - Intergenic
1122677888 14:103432415-103432437 GGAGGGAGGAAGATTGAGGTGGG - Intronic
1122867661 14:104614745-104614767 GCAGGGAGGAAGGAGGAGGAAGG + Intergenic
1123072126 14:105647038-105647060 GGTGGGAGGCAGGATGAGCAGGG - Intergenic
1123091985 14:105746006-105746028 GGTGGGAGGCAGAATAAGCAGGG - Intergenic
1123097446 14:105773216-105773238 GGTGGGCGGCAGAATGAGCAGGG - Intergenic
1123097518 14:105773529-105773551 GGTGGGAGGTAGAACGAGTAGGG - Intergenic
1123097581 14:105773763-105773785 GGTGGGAGGCAGGATGAGTAAGG - Intergenic
1123804894 15:23860660-23860682 GCTGGGAGGGGGGATCAGGAGGG + Intergenic
1124633563 15:31350960-31350982 GCTGGGAGGGAGTGTGTGGATGG + Intronic
1124904701 15:33857679-33857701 ACGAGGAGGAAGAGTGAGGACGG - Intronic
1125257759 15:37785643-37785665 GCTGGGAAGAAGAGTTATGAAGG - Intergenic
1126101543 15:45120965-45120987 GCTGGGAGGATGTGTGAGGTGGG - Intronic
1126290743 15:47074663-47074685 GTTGGTTGAAAGAATGAGGAAGG - Intergenic
1127305454 15:57701208-57701230 GCTGGGAGGAAGGATGACAAAGG - Intronic
1127663898 15:61125707-61125729 ACTGGGAGGAGAAAAGAGGAAGG - Intronic
1127733320 15:61819700-61819722 GCTGAGAGGAAGGATGGAGAAGG - Intergenic
1127935415 15:63632361-63632383 GAAGGGATGAAGAATGAGGCAGG + Intronic
1128087452 15:64895784-64895806 GGTGGGAGGAAGAAGGGTGAAGG + Intronic
1128354546 15:66915646-66915668 GCCAGGAAGAGGAATGAGGATGG + Intergenic
1128447215 15:67774613-67774635 GCTGGAAGGAATAAAGAGGCTGG - Intronic
1128768180 15:70263791-70263813 GCTGGGAGGAGAGATGAGGCTGG - Intergenic
1128790491 15:70429958-70429980 CCCTGGAGGAAGAAAGAGGAGGG + Intergenic
1128992597 15:72272917-72272939 GTTGGGAGGAACAAGCAGGAAGG + Intronic
1130726661 15:86446001-86446023 AGAGGGAGGAAGAATGAAGAAGG + Intronic
1130764130 15:86852742-86852764 GCAGGGAAGAGGAATGAGGCAGG + Intronic
1130866731 15:87939877-87939899 GCTGGGTGGAAGAGTCTGGAAGG + Intronic
1130915822 15:88303739-88303761 GCTGGGGGGAGGAAGGAGAAAGG - Intergenic
1131399996 15:92116813-92116835 GATGGGAGGAAGAACTTGGAAGG + Intronic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1131687677 15:94788157-94788179 GAGGGAAGGAAGAAAGAGGAAGG - Intergenic
1132093896 15:98967854-98967876 GCTGGGAGGAAGAAGGAATAGGG + Intergenic
1132147000 15:99435069-99435091 GCAGGGAGGAAGAATCGAGATGG - Intergenic
1132401288 15:101507292-101507314 GCTGGAAGTACTAATGAGGAAGG + Intronic
1133654558 16:7847891-7847913 ACTGGGAGGGAAAATGAGGATGG + Intergenic
1133705461 16:8350432-8350454 GGTGGGAGAAAGACTGCGGATGG - Intergenic
1133723879 16:8519888-8519910 ACTGGGAGGTTGAATGAGGTAGG - Intergenic
1133817884 16:9212126-9212148 GCTGGGTGGAGGGAGGAGGAGGG + Intergenic
1133843773 16:9435549-9435571 GGTGGGAGGTAGAACGAGTAGGG + Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1134040397 16:11063971-11063993 GATTGGAGGAAGAAAGGGGAAGG + Intronic
1134183789 16:12067380-12067402 GCATGGAGGATGGATGAGGAAGG + Intronic
1134287165 16:12871984-12872006 GGGAGGAGGAAGAAGGAGGAAGG - Intergenic
1134692152 16:16197942-16197964 GGTGGGAGGGGGAAGGAGGAGGG + Intronic
1135168485 16:20162366-20162388 CCAGGGAGGAAGAAAGAGGAAGG + Intergenic
1135738462 16:24953180-24953202 GCTGTCAGGAGGAATGATGAGGG + Intronic
1136092063 16:27927666-27927688 GCTGGGTGGAGCACTGAGGATGG - Intronic
1136393585 16:29980468-29980490 GGTGGGAGGAAGGATGGGGATGG - Intronic
1136395847 16:29991997-29992019 ACTGGCAGGAAGGATCAGGATGG + Intronic
1137520582 16:49191708-49191730 GATTGGAGGAAGCATGAGCATGG + Intergenic
1137550222 16:49432484-49432506 GTGGGGAGGAAGCATCAGGAAGG - Intergenic
1138266757 16:55665098-55665120 GCTGGGAGGAAGTAGGGGCAGGG + Intronic
1138589591 16:57992481-57992503 GCTGGGAAGAAGAAGGAAGGAGG - Intergenic
1139321582 16:66118575-66118597 GCTGGGAGGATGAAGAGGGAAGG + Intergenic
1139711568 16:68780262-68780284 ACAGGGAGGAAGGATAAGGAGGG - Intronic
1139821023 16:69721383-69721405 GGTGGGAGGTAGAAGGTGGAAGG - Intronic
1139946044 16:70642910-70642932 GCTGGGAGGAAGAGGGAATAGGG + Intronic
1140509659 16:75497893-75497915 GGAGGGAGGAAGAATAGGGAGGG - Intergenic
1140710941 16:77677041-77677063 CCTGGGAGTAAGAATAGGGAAGG + Intergenic
1140731212 16:77858287-77858309 GATTGGAAGAAGAAAGAGGAAGG + Intronic
1141156098 16:81598111-81598133 GCTGGGAGGATGAATGTGCTCGG + Intronic
1141320636 16:83005330-83005352 ACAGGGAGAAAGAGTGAGGAGGG - Intronic
1141456202 16:84144462-84144484 GCTGGGAAGAAGAACCAGGCAGG - Intronic
1141719826 16:85750183-85750205 GCCCGGAGGAAGAGGGAGGAAGG - Intronic
1141734668 16:85844252-85844274 GAAGGAAGGAAGAAGGAGGAAGG - Intergenic
1141849035 16:86631437-86631459 ACTGGGAGAGAGGATGAGGACGG - Intergenic
1141957277 16:87381404-87381426 GCTTGGAGGGTGAATGAGGTAGG - Intronic
1141988802 16:87597999-87598021 GGTGGGAGGAAGGAAGAAGAGGG - Intergenic
1142003242 16:87675989-87676011 GCTGGGAGGAGGGATGGGGAGGG + Intronic
1142005359 16:87687203-87687225 GCTGTGAGGACGACTGAGGAAGG - Intronic
1142251429 16:88993728-88993750 GGAGGGAGGAGGAAAGAGGAAGG - Intergenic
1142398171 16:89844899-89844921 GCTGGGAGTAAGAGTGAAGGAGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141744 16_KI270728v1_random:1771553-1771575 GCTGGGATGATGGAGGAGGAGGG - Intergenic
1142827048 17:2519979-2520001 TCTGGATGGAAGAATGAAGAAGG - Intergenic
1143142444 17:4748798-4748820 GCTGAGAGAAAAGATGAGGAGGG - Intergenic
1143179415 17:4974807-4974829 GCTGGGGGGAAGAGTGTGTACGG - Intronic
1143645648 17:8228417-8228439 CCTGGGAGGAAGAGGGATGAGGG - Intronic
1143710144 17:8728698-8728720 TCTGGGAGGCAGACTGACGAGGG + Intergenic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143982739 17:10883910-10883932 ACAGGGAGGAAGCATTAGGAGGG - Intergenic
1144131411 17:12250695-12250717 GCTTTGGGGAAGAGTGAGGAAGG + Intergenic
1144156914 17:12513322-12513344 CCAGGGAGGAAGAATGGGGTGGG + Intergenic
1144273303 17:13640847-13640869 GCTGGATGGAAAAATGAGGGTGG - Intergenic
1144376657 17:14649603-14649625 TCTGGGTGGAAGAAGGGGGAAGG - Intergenic
1144813260 17:18015666-18015688 GCTGGGTGGAAGCATGAGGCTGG - Intronic
1144851899 17:18248033-18248055 CCTGGCAGGAAGGATGAGCATGG + Exonic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1144922247 17:18773755-18773777 GGTGGGAGGGGGAATCAGGATGG + Intronic
1144968339 17:19091632-19091654 GCTGGGAGTTACAATGAGGAAGG - Intergenic
1144979578 17:19160431-19160453 GCTGGGAGTTACAATGAGGAAGG + Intergenic
1144988644 17:19217801-19217823 GCTGGGAGTTACAATGAGGAAGG - Intronic
1146150965 17:30471445-30471467 GTTGGGAGGACAAAAGAGGAAGG + Intergenic
1146399520 17:32492206-32492228 GCTGGGAGGAAGTGTGGGGGCGG - Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146572715 17:33966914-33966936 GCTAGGAGGAAGACTGGGGTGGG - Intronic
1146692933 17:34889235-34889257 GGTGGCAGGAAGCATGAGGAGGG - Intergenic
1146720660 17:35121290-35121312 CCTGGGAAGGAGAATAAGGATGG - Exonic
1147251788 17:39156945-39156967 GCAGGGAGGAAGGAACAGGAGGG + Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1148081338 17:44968859-44968881 GCTGGAAGGTAGGATGAGAAAGG + Intergenic
1148236751 17:45974279-45974301 GCAGGGAGGAGGAGTGAGGAGGG - Intronic
1148778332 17:50108353-50108375 GATGGGTGGGAGAATGAGGCTGG - Exonic
1149265697 17:54925355-54925377 GCTGGCAGGAAACAGGAGGAAGG - Intronic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1150193609 17:63270809-63270831 GGTGGGAGGAGGTAGGAGGAGGG - Intronic
1150424830 17:65068994-65069016 GCTGGGAGGGAGGGGGAGGAAGG - Intergenic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1151216154 17:72577757-72577779 GCTTGGAGGGAGGAAGAGGAGGG - Intergenic
1151355370 17:73555012-73555034 GCTGGGAGGAAGGAGGATGGGGG + Intronic
1151420525 17:73994095-73994117 GCTGGGAGGAAGATGGAAGAGGG + Intergenic
1151831457 17:76554589-76554611 CGTGGCAGGAAGAGTGAGGATGG - Intergenic
1152016285 17:77752880-77752902 GCTGGGAAGAAGCCTGGGGAAGG + Intergenic
1152243047 17:79170150-79170172 GAAGGGAGGAGGAAGGAGGAAGG + Intronic
1152337138 17:79705312-79705334 GGTGGGAGGAACACTGAGGCTGG + Intergenic
1152596914 17:81242239-81242261 GCTGGGCACAAGAAGGAGGAAGG - Intergenic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153330417 18:3867666-3867688 GTTGGGAGGAGAAATGGGGATGG + Intronic
1153483299 18:5569509-5569531 GATGAGAGGAAGGATGAGAAAGG + Intronic
1153527899 18:6015036-6015058 GCGGGGAGGAAAGATGATGAGGG + Intronic
1153592773 18:6691657-6691679 GCAGGGGGAAAGAATGAGGTAGG - Intergenic
1154359714 18:13649398-13649420 GCTGGATGGAAGATAGAGGATGG - Exonic
1155022107 18:21905978-21906000 GCTGGGAGGAAAGGTGAGGCTGG + Intergenic
1155034944 18:22018273-22018295 TCTGGGAGGAAGGAAGAGGCAGG - Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156224207 18:35087117-35087139 GCTGGGAGGCTGTATGAAGATGG - Intronic
1156388293 18:36626357-36626379 GCTGGGAGGAAGACCGAGAATGG + Intronic
1156446275 18:37239426-37239448 GCTGGCAGGAAGAGGGAGAAAGG + Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1156908684 18:42385068-42385090 GATGGAGGGAAGAAAGAGGAAGG - Intergenic
1157042843 18:44060760-44060782 GCCTTGAGGAAGAATGAGGTAGG + Intergenic
1157288669 18:46394495-46394517 GCTGGGGGGAAGGTGGAGGATGG - Intronic
1157466886 18:47955083-47955105 GCTGTCAGGAAGAATGTGAAAGG - Intergenic
1157549576 18:48572123-48572145 GGAGGAAGGAAGAAAGAGGAAGG - Intronic
1157954973 18:52086565-52086587 GCTGGTTTGAAGAATGAGGGGGG + Intergenic
1158425680 18:57337983-57338005 GATGACAGCAAGAATGAGGAAGG - Intergenic
1160019920 18:75172488-75172510 GCTGGGAGAGAGTAGGAGGAAGG + Intergenic
1160135303 18:76266365-76266387 GGAGGGAGGAAGGAAGAGGAAGG + Intergenic
1160367041 18:78335399-78335421 GTTAGGAGGAAGGAAGAGGAGGG + Intergenic
1160500962 18:79400868-79400890 GCTGGGGGGAGGGAGGAGGATGG - Intronic
1160695175 19:480411-480433 GCTGGGAAGGATGATGAGGATGG + Intergenic
1160798468 19:956433-956455 TCTCGGAGGAAGAACGTGGAGGG + Intronic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161281013 19:3445770-3445792 GCTGGGAGGATGGAGGAGGTGGG + Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161403952 19:4081646-4081668 GCAGGGAGGAGGAGGGAGGAGGG - Intergenic
1161755189 19:6128072-6128094 GCTGTGAAAAAGAATGAGAAAGG + Intronic
1161762101 19:6181319-6181341 GGAGGGAGGAAAAAAGAGGAAGG + Intronic
1161808074 19:6456531-6456553 GCTGGGGGGAAGAAAGGGGGTGG + Exonic
1162062169 19:8102693-8102715 GCTGGGAAGAAGGTTGGGGAGGG + Intronic
1162371096 19:10279888-10279910 GATGGGAGGAAGGGTGAGGTTGG + Intronic
1162516738 19:11152764-11152786 GAGGGGTGGAAGAAGGAGGAGGG + Intronic
1163092675 19:15031806-15031828 GCAGGGAGAAGGAAGGAGGAAGG + Intergenic
1163210769 19:15838533-15838555 TCCAGGAGGAAGAAAGAGGAAGG - Intergenic
1163463506 19:17453432-17453454 GCTGACAGGAAGAAGGAGGCTGG - Intronic
1163554212 19:17983339-17983361 GCTGGGTGGAGGGATGAGGATGG - Intronic
1163594262 19:18211705-18211727 ACTGGGAGGAAGTAAAAGGAGGG - Intronic
1163691777 19:18742319-18742341 GCTGGGAAGGACCATGAGGAAGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1164461780 19:28455091-28455113 GCTGGGAAGAGGCATGAGGTGGG - Intergenic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1165446955 19:35861743-35861765 GAGGGGAGGAAGAAGCAGGAGGG - Intronic
1165859326 19:38899059-38899081 GCTGGGAGGCAGGTTTAGGAGGG + Intronic
1166048705 19:40245178-40245200 GCTGGGGGAAAGATTGAGGCAGG + Intronic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166617839 19:44267095-44267117 GGAGGGAGGTAGAAGGAGGAAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166986592 19:46663696-46663718 GCTGGAAGGTAGAATAGGGAGGG + Intergenic
1167607398 19:50488737-50488759 GCTGGGAGGAGAGAGGAGGAGGG + Exonic
1167621617 19:50563962-50563984 GATGGGGGGATGAAGGAGGAGGG + Intronic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
1168416449 19:56172130-56172152 GAAGGGAGGAAGAGAGAGGAGGG + Intergenic
1202695341 1_KI270712v1_random:119365-119387 ACTGGGAGGGAGAATGAAGGGGG - Intergenic
925040108 2:725987-726009 TCTGGGAAGAAGAGTTAGGAGGG + Intergenic
925423216 2:3728195-3728217 GCTGGGAACGAGAAAGAGGAAGG + Intronic
925473055 2:4183357-4183379 GCAAGGAGGAAGGAGGAGGAGGG + Intergenic
925718801 2:6808852-6808874 GCAAGGAGAAAGAGTGAGGAAGG + Intergenic
926106468 2:10155388-10155410 GCTGGATGGATGAATGAGCAAGG - Intronic
926365074 2:12125605-12125627 GGTGGGAGTGAGAATAAGGAAGG - Intergenic
926966717 2:18423107-18423129 GGTGGGAGGGTGACTGAGGATGG + Intergenic
927042369 2:19242267-19242289 GATGGGAGGAAGATTTAGAAAGG - Intergenic
927598424 2:24418736-24418758 GCTGGGAGGGAGTCTGGGGAAGG - Intergenic
927825999 2:26310785-26310807 GATGGGTGTAAGAATGAGCAGGG + Exonic
927869905 2:26616723-26616745 GGTAGGAGGAGGAAGGAGGATGG - Intronic
927960212 2:27236565-27236587 GATGGGAAGAAGAAAGAGGGAGG + Intronic
928249693 2:29664671-29664693 GCTGGGTTGCAGCATGAGGATGG - Intronic
928877442 2:36056656-36056678 GCAGGAAGGAAGAAGGAGGGAGG + Intergenic
929541805 2:42828636-42828658 CCAGGGAGGAAGAGTGAGGGCGG - Intergenic
929948582 2:46389080-46389102 GCTGGAAGGAAGATTTGGGAAGG - Intergenic
929999203 2:46849599-46849621 GGTGGGAGGAAGTTTGGGGATGG + Intronic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931051574 2:58421135-58421157 GATGGAAGGAAGAAGGAAGAAGG + Intergenic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931385669 2:61795557-61795579 GAAGGAAGGAAGAAAGAGGAAGG + Intergenic
931655053 2:64503144-64503166 CTTGGAAGAAAGAATGAGGAAGG + Intergenic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
932208140 2:69902199-69902221 GGAGGGAGGAGGAAGGAGGAAGG - Intronic
932490060 2:72114722-72114744 GCTGCGTGGAGGACTGAGGAGGG - Intergenic
932691486 2:73917429-73917451 GTTGGGAGGCAGTATGGGGAAGG - Intronic
932701996 2:73998419-73998441 GCTGGTAGGAAGCACGAAGATGG + Intronic
933783234 2:85816411-85816433 GCTGGGAGGGAGGAGGAGAAGGG + Intergenic
934045356 2:88169212-88169234 GATAGGAGGAAGAAAGAGGGGGG + Intergenic
934276507 2:91576413-91576435 ACTGGGAGGGAGAATGAAGGGGG - Intergenic
934546549 2:95221972-95221994 GAAGGGAGGAAGAAAGAGAAAGG - Intronic
934573617 2:95386553-95386575 CCTGGGAGGAGGGAGGAGGAGGG + Intergenic
934767155 2:96886071-96886093 GTTGGTGGGAAGGATGAGGAGGG - Intronic
934769143 2:96896790-96896812 GCTGGAAGGAAGAGAGAGGCAGG - Intronic
935095629 2:99941701-99941723 GGAAGGAGGAAGAAGGAGGAAGG - Intronic
935469429 2:103439343-103439365 GCCTGGGGGAAGAAGGAGGAAGG - Intergenic
935750673 2:106231110-106231132 GCTGGGAAGAGGGAAGAGGAGGG - Intergenic
935816437 2:106850317-106850339 GCTGGGAAGTAGAAAGAGGCAGG + Intronic
935987490 2:108688881-108688903 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936126316 2:109791578-109791600 GCTGGAGGCAAGAGTGAGGAAGG + Intergenic
936218377 2:110579890-110579912 GCTGGAGGCAAGAGTGAGGAAGG - Intergenic
936241313 2:110790807-110790829 GCTGGGAGGAGCCAGGAGGAGGG - Intronic
936867103 2:117087376-117087398 GATGGGAGAAAGAAAGAGAAAGG + Intergenic
936935047 2:117831408-117831430 GCTGGGGGGTAGGAAGAGGATGG + Exonic
937266998 2:120623044-120623066 GCAGGGAGCAGGAATGAGGGCGG + Intergenic
937338647 2:121077099-121077121 GCAGGGAGGATGCATCAGGATGG - Intergenic
937378176 2:121352150-121352172 GATGGGAGGAGGAAGGAGCATGG + Intronic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938164450 2:129014575-129014597 GCTGGGAGGGAGGAGGAAGAGGG - Intergenic
938730623 2:134144234-134144256 GCTGTGAGGAAGCATGATGCTGG + Intronic
939175751 2:138745820-138745842 GGTGGGGGGAAGAAGCAGGAAGG + Intronic
939327497 2:140712531-140712553 ACTGGTTGGAAGAAAGAGGATGG - Intronic
939517745 2:143190449-143190471 TCTGGGAGGTTGACTGAGGATGG + Intronic
939870420 2:147520460-147520482 GCTGGGAGGAAGTTTCAGGCAGG - Intergenic
939902784 2:147870061-147870083 TATGGGAGGACGTATGAGGAGGG + Intronic
940106782 2:150110100-150110122 GCTGGGAGGAAGTGTGTGCATGG + Intergenic
942277887 2:174336065-174336087 GGAGGGAGCAAGAAGGAGGAGGG - Intronic
942409637 2:175694975-175694997 GATGTGAGGAAGCATGGGGATGG - Intergenic
942608555 2:177717308-177717330 CCTGGGAGGAAGATGGATGAGGG - Intronic
942960981 2:181829644-181829666 GTTGGGAGGAAGGAGGGGGACGG - Intergenic
943264574 2:185712020-185712042 ACTTGGAGGAAGAATTAGGGTGG + Intergenic
944412605 2:199458354-199458376 GCAGGGAGGAGGGAAGAGGAAGG + Intronic
944794013 2:203163573-203163595 TTTGGGAGGATGAAGGAGGAAGG - Intronic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945355772 2:208837562-208837584 GGTGGGAGGAGGAGTGAGGGGGG + Intronic
945364316 2:208931995-208932017 GCTATGAGGAAGAAAGAAGATGG - Intergenic
945649362 2:212539056-212539078 GCTGAGAGGAAAAAGAAGGACGG - Intergenic
945772392 2:214060271-214060293 GTTGGGAGGAAGAAGGAGCCAGG + Intronic
946182695 2:217958477-217958499 GCTGGGATGGAGAATGACGATGG + Intronic
946426646 2:219601966-219601988 GCTGGGACAAGGAAAGAGGAGGG - Exonic
946771348 2:223092178-223092200 GGTGGGAGGAAGTAAGAGTAGGG - Intronic
946963132 2:225006143-225006165 GGTGGGGAGAAGAATGAAGATGG - Intronic
947445426 2:230159208-230159230 GCAGGGAGCAAGCATGTGGATGG - Intergenic
947461862 2:230310527-230310549 GCAGGCAGGAAGTCTGAGGAAGG - Intronic
947602518 2:231463495-231463517 CCTGGGAGGAAAAATGTGGGCGG - Intronic
947760949 2:232603425-232603447 GGTGGAAGGAGGAAGGAGGAAGG + Intergenic
948069765 2:235111113-235111135 GCTGGGAGGAGGAAGGAATAGGG + Intergenic
948220181 2:236263057-236263079 GTTGGGAGGGAGAATGGGGGTGG + Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948424243 2:237877497-237877519 GCCGGGATGAAGACAGAGGAGGG + Intronic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
948556212 2:238813267-238813289 GCTGTGAGGCTGAAAGAGGAAGG - Intergenic
948577649 2:238964993-238965015 GGAGGGAGGAGGAAAGAGGAAGG - Intergenic
948577757 2:238965352-238965374 GGAGGGAGGAGGAAAGAGGAAGG - Intergenic
948600807 2:239106576-239106598 TCTGGGAGGAGGGAGGAGGAAGG - Intronic
948615497 2:239196153-239196175 GGTGGGGGGAAGAGAGAGGATGG + Intronic
948720081 2:239893964-239893986 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720111 2:239894093-239894115 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720166 2:239894350-239894372 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720177 2:239894396-239894418 GCAGGGAGAAGGAATGAGGCTGG - Intronic
1168800306 20:640420-640442 GGAGGGAGGAAGAATGAGCTAGG - Intergenic
1169300151 20:4435228-4435250 GGTGAGAGGAAGAAAGAGAAAGG + Intergenic
1169522588 20:6389527-6389549 GATGGGAGCAAGAATTAAGAAGG - Intergenic
1169953319 20:11072843-11072865 GCTAGGAGGAAGCATGGGAAGGG - Intergenic
1170067967 20:12335046-12335068 GCTGGATGGAAGAGTGAGGAGGG + Intergenic
1170668231 20:18405647-18405669 GCAGGGAGGATGAATGATGTAGG - Intronic
1170707160 20:18754654-18754676 GCTGGAAGCTTGAATGAGGAAGG - Intronic
1170876537 20:20254948-20254970 GCTGGGAGGAAGAGTGGGCTGGG - Intronic
1171185447 20:23121211-23121233 GCTGGGAGACAGAGTGAGGCAGG - Intergenic
1171279398 20:23883343-23883365 GCAGGGAGGGGGAAGGAGGAAGG - Intergenic
1171437511 20:25134781-25134803 CCTGGGTGGTAGAATGAGGAGGG - Intergenic
1171538707 20:25925056-25925078 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1171802325 20:29635226-29635248 GTTGGTTGAAAGAATGAGGAAGG - Intergenic
1171841649 20:30220371-30220393 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1172114039 20:32563208-32563230 GGAGGGAGGGAGAGTGAGGAGGG + Intronic
1172156124 20:32826163-32826185 GCTGAGAGGAAGAAACAGGGTGG - Intronic
1172163929 20:32887200-32887222 GCTGGGAGGAAGGAGCAGGGAGG - Intronic
1172433960 20:34915103-34915125 GCTGGGAGGACCAGTGAGAAGGG + Intronic
1172628979 20:36365810-36365832 GATGGGAGGAATAAGGAGAAAGG - Intronic
1172864867 20:38088252-38088274 TCTGGGAAGAATAATGAGGCAGG - Intronic
1172949468 20:38713468-38713490 GGTGGCAGGAAGACTTAGGAGGG + Intergenic
1173299530 20:41789403-41789425 GTTGGGAGGAAAAAAGAGGGTGG + Intergenic
1174499055 20:50970848-50970870 GCTGGAAGGGAGATTGTGGAAGG - Intergenic
1175293725 20:57894829-57894851 GAAGGAAGGAAGAAGGAGGAAGG + Intergenic
1175325808 20:58127837-58127859 GCTGGGAGGAAGAGGGAGTGGGG - Intergenic
1175452473 20:59081438-59081460 GCTGGGAGGAGGAGTGAGCCGGG + Intergenic
1175872323 20:62214356-62214378 GCTGGGAGGAAGATGGAGGGAGG - Intergenic
1175955391 20:62606478-62606500 GGTGGGAGGAAGGGAGAGGAAGG + Intergenic
1176057097 20:63154711-63154733 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1176057114 20:63154763-63154785 GGAGGGAGGAAGAGGGAGGAGGG - Intergenic
1176070475 20:63223611-63223633 GCTGGGAGGCAGCATGTGGAAGG + Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1176263306 20:64194625-64194647 CCTGGGAGGAAGCATGAAAAAGG + Intronic
1176430349 21:6571537-6571559 GCAGGCAGGAAGAGTGAGCAAGG - Intergenic
1177116049 21:17088205-17088227 GGAGGGAGGAGGAAGGAGGAAGG + Intergenic
1177144636 21:17394188-17394210 GCTCTTAGAAAGAATGAGGAAGG - Intergenic
1177482571 21:21709766-21709788 GCAGGAAGGAAGAGAGAGGAGGG + Intergenic
1178016116 21:28347567-28347589 GAAGGAAGGAAGAAGGAGGAGGG - Intergenic
1178721092 21:35009680-35009702 GCTGGCAAGAGGAATGAGCAGGG - Intronic
1178948562 21:36967103-36967125 GGTGGGAGGCGGATTGAGGAGGG + Intronic
1179165353 21:38931321-38931343 GGTGGGAGCAATAATGAGGGTGG - Intergenic
1179168739 21:38956340-38956362 GCTGGCAAGAAGAGTGAGCATGG - Intergenic
1179474422 21:41634220-41634242 GCCGGGAGAAGGAAGGAGGAGGG - Intergenic
1179705743 21:43178999-43179021 GCAGGCAGGAAGAGTGAGCAAGG - Intergenic
1181260800 22:21595834-21595856 GCTGAGAGGAAGTATGCTGAAGG - Intronic
1181692398 22:24571314-24571336 GCTGGGAGGCAGCATGCTGAGGG - Intronic
1181896549 22:26113198-26113220 AGTGGGAGGAAGAAAGAGAAGGG + Intergenic
1181964852 22:26649326-26649348 GCTGGGAGGAAGGCAGAGAAAGG + Intergenic
1181999652 22:26909943-26909965 GCTGGGAGAAAGAGTGAAAAGGG + Intergenic
1183001411 22:34862587-34862609 GCAGTGAGGAAGAAGGAGAATGG - Intergenic
1183088462 22:35503626-35503648 TCTGGGAGGGAGAAAGAGGTGGG - Intergenic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183630409 22:39029195-39029217 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183633870 22:39049281-39049303 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183660832 22:39220312-39220334 AAAGGGAGGAAGAAAGAGGATGG + Intergenic
1184712826 22:46263137-46263159 GCTGGGCCGCAGACTGAGGAGGG + Exonic
1184879630 22:47296749-47296771 GCTGGGAAGATGAAAGAGCACGG + Intergenic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
1185049589 22:48546844-48546866 GCGGGGAGGACGATTGCGGATGG + Exonic
949944624 3:9180198-9180220 GCAGGGAACAAGATTGAGGAGGG + Intronic
950546036 3:13638625-13638647 GGAGGGAGGAGGAAGGAGGAGGG - Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951051317 3:18097087-18097109 GGAGGGAGGAAGAATTAGCAGGG + Intronic
951097886 3:18652929-18652951 TCAGGGAGGAGGAATGAGAAGGG + Intergenic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
951114600 3:18845404-18845426 GGAGGGAGGAAGAAAAAGGAAGG - Intergenic
951617343 3:24562423-24562445 TATGGGAGAAAGACTGAGGAAGG + Intergenic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
952505065 3:33999760-33999782 GCTGAGAGGGATAATGAGGTGGG - Intergenic
952559483 3:34573956-34573978 GGAGGAAGGAAGAAGGAGGAAGG - Intergenic
952610811 3:35206589-35206611 TGTGGGAGGAAAAATGAAGAGGG - Intergenic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
952901379 3:38114167-38114189 GCTGGGAGGGAGAGTGGAGATGG + Intronic
953230268 3:41058383-41058405 GGAGGGAGGAAGAGGGAGGAGGG + Intergenic
953383556 3:42492175-42492197 GAAGGAAGGAAGGATGAGGAGGG - Intronic
953443565 3:42941783-42941805 CCTGGGAAGAAGAGTCAGGATGG - Intronic
955086731 3:55709851-55709873 GCTGGGAGGGAGAACGAGACAGG + Intronic
955148890 3:56347407-56347429 GCTGGGAGGCTGGAGGAGGAAGG + Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955770233 3:62378149-62378171 GCTGGAGGGAAGAAGGAGGGAGG - Intergenic
956084732 3:65597504-65597526 GCTGGGAGGAAGGGGGAGGGGGG - Intronic
956189372 3:66594156-66594178 GCTTTTAGAAAGAATGAGGAAGG + Intergenic
956741576 3:72279965-72279987 GCAGGGAGGAAGGAGGAGGAGGG + Intergenic
956749538 3:72335200-72335222 GCCCGGAGGCAGGATGAGGATGG + Intergenic
956797336 3:72728804-72728826 ATTTGGGGGAAGAATGAGGAGGG - Intergenic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
957277693 3:78109933-78109955 CCAGGAAGCAAGAATGAGGAGGG + Intergenic
957507413 3:81140816-81140838 GAAGGGAGGGAGAATGAGGAAGG + Intergenic
959378015 3:105608721-105608743 GATGGGAGTAAGAAAGGGGATGG - Intergenic
959384728 3:105689086-105689108 GCTAGGAGGAAAAATAAGCAGGG - Intronic
959663971 3:108901206-108901228 GCTAGGAGATAGAATGTGGATGG + Intergenic
959671132 3:108978654-108978676 GCAGGTAGGAAGAAAGAGAAAGG - Intronic
959744377 3:109759615-109759637 GCTGGGGGAAAGAATGGGAAAGG - Intergenic
960453556 3:117841458-117841480 GCTACCAGGAAGAAAGAGGAGGG - Intergenic
960660747 3:120055576-120055598 ACTGGGAGTTAGAGTGAGGAGGG + Intronic
960739023 3:120812361-120812383 GAAGGCAGGAAGAATGAGCAAGG - Intergenic
960968796 3:123124431-123124453 GTTGGGGGAAAGAATGAGGAAGG + Intronic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961381737 3:126500038-126500060 GCAGGTAGGAGGAAGGAGGAGGG - Exonic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
962806458 3:138930840-138930862 GCTGGGTGCAAGAATGAGGGTGG - Intergenic
962844204 3:139260832-139260854 GCTGTGAGCATGAAGGAGGAAGG - Intronic
963068969 3:141286858-141286880 GCTGTGAGGATGAAGGAGAAGGG + Intronic
963495994 3:146061851-146061873 GCTGGGAGGAGCAGTGAGGGTGG + Intergenic
964535440 3:157716272-157716294 GAGGGGAGGAATAATGAAGATGG + Intergenic
964909267 3:161758152-161758174 GATTGGAGGAACAAGGAGGAGGG + Intergenic
965884029 3:173422602-173422624 GCTGGCAAGGAGAAAGAGGAAGG - Intronic
966202469 3:177371605-177371627 GCTGGAACTAAGGATGAGGAGGG - Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
966861564 3:184233554-184233576 GCTGGAAGGGAGCATGAGGAGGG - Exonic
966915157 3:184580630-184580652 GCTGGGAGGGAGACTGGGGGCGG + Intronic
967364486 3:188670354-188670376 GATGGGAGAAAGAGTGAGGAAGG + Intronic
967813988 3:193783642-193783664 GATGGGAGGAAGGAGTAGGAGGG - Intergenic
967888846 3:194351048-194351070 GCTGGGAAGAGGCAGGAGGAAGG - Intronic
968259208 3:197305920-197305942 GCTAGCAGGAAGAAGGAGGTGGG - Intergenic
968585392 4:1413937-1413959 GCGGGGAGGAAGGAGGAGTAAGG + Intergenic
968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG + Intergenic
968626694 4:1629131-1629153 GCTGGGAAGAGGAAGGAGCAGGG + Intronic
968909040 4:3467276-3467298 GCGGGAGGGAAGAAGGAGGAGGG - Intronic
969034267 4:4239940-4239962 ACTGGGAGGGAGAATGAAGGGGG + Intronic
969075490 4:4574852-4574874 GTTGGGAGGAAGGGGGAGGAAGG - Intergenic
969161077 4:5259671-5259693 GCTATTAGAAAGAATGAGGAAGG - Intronic
969286312 4:6204507-6204529 AGTGGGAGGAAGCATGATGAGGG + Intergenic
969511786 4:7622206-7622228 ACAGGGAGCAAGAAGGAGGAGGG + Intronic
969568211 4:7992639-7992661 GCAGGGAGGCAGAGTGGGGAGGG + Intronic
969699904 4:8762259-8762281 GCTGGGGAGAGGAGTGAGGAGGG - Intergenic
969717910 4:8877350-8877372 GATGGGAGGAGGAAGGAAGAGGG + Intergenic
970218592 4:13784651-13784673 GCAGGGAGGAACAGTGTGGAAGG + Intergenic
970301307 4:14684112-14684134 GGTGGGGGGAAGAAAAAGGAGGG + Intergenic
970444165 4:16110166-16110188 GGAAGGAGGAAGAAGGAGGAAGG + Intergenic
971000000 4:22311304-22311326 GATGGGACGAAGTATGGGGAAGG + Intergenic
971641907 4:29145066-29145088 TCTGGGTGGAAGAAGGGGGAAGG - Intergenic
972894595 4:43604172-43604194 TCTGGGAGGAAGAAAGAGCAAGG - Intergenic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973185558 4:47324024-47324046 GCTTGGAGTAATAATGATGAAGG + Intronic
974017181 4:56657899-56657921 TCTGGTAGGAAAAATCAGGAGGG + Exonic
974081187 4:57214915-57214937 GCTGGGAAGATGAACTAGGATGG - Intergenic
975237499 4:72016478-72016500 GCTGGGATCAAAAATGAAGATGG - Intergenic
975364433 4:73512257-73512279 GCTGGGAGGAATAGTGAGGGTGG - Intergenic
975489026 4:74968530-74968552 GCATGGAAGAAGAAAGAGGAAGG + Intronic
975733566 4:77360253-77360275 GCTAGGGGAAAGAATGAGGAAGG - Intronic
975737001 4:77390677-77390699 GCTCAGAGAAAGAATAAGGAGGG - Intronic
975973984 4:80073825-80073847 GGTGGGGGGAAGAGAGAGGAGGG - Intronic
976193056 4:82507357-82507379 GCAGGGAGGTAGAGTGAAGAGGG + Intronic
976481835 4:85555669-85555691 GCTGGGAGGCAGCAGGAGAAGGG + Intronic
977476166 4:97512650-97512672 GGTGGGAGGAAGAAGAAGGAAGG + Intronic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980126087 4:128775732-128775754 GCTGGGACCAAGAATGGGGCAGG - Intergenic
981075200 4:140584379-140584401 TTAGGGAGGAAGAATGGGGAAGG - Intergenic
981284941 4:143005680-143005702 GCTGGCAGAAAGATTGAGGTTGG - Intergenic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
981579308 4:146236262-146236284 GCTGGGAGAAGGAAACAGGAGGG - Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
981679640 4:147381835-147381857 GCGTGGAGGAAGAATCAAGAGGG - Intergenic
982165752 4:152612314-152612336 GCAGGAAGGAAGAAGGGGGAAGG - Intergenic
982339659 4:154283888-154283910 GCTGGAAAGGATAATGAGGATGG - Intronic
982612168 4:157588818-157588840 GATAGGAGGAAGAGTGAGGTTGG - Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983891446 4:173034269-173034291 GCAGTGAGGAAGATGGAGGAGGG - Intronic
984381961 4:179005725-179005747 GAAGGGAGGAAGAAGGAGCAGGG + Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985191062 4:187373396-187373418 GCTGGCAGGAAGTGTGGGGAAGG + Intergenic
985504154 5:269179-269201 GATGGGAGGGAGAATAAAGATGG + Intergenic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985632430 5:1021021-1021043 GCTGTGAGGCAGGATGAAGAGGG + Intronic
986310340 5:6546544-6546566 GCTGTGAGGTTGAATGAGGCTGG - Intergenic
986643456 5:9893799-9893821 TGTGGGAGGAAAAAGGAGGAAGG + Intergenic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
988338334 5:29935828-29935850 GCGAGGAGGAAGAAAGAGTAGGG + Intergenic
989749930 5:44881185-44881207 GGTGGGAGGAAGAGGGCGGAAGG + Intergenic
990115545 5:52385906-52385928 GGAGGGAGAAAGAATGAAGAAGG + Intergenic
990869225 5:60413446-60413468 GATGAGAGGAGGAAGGAGGAAGG + Intronic
992028502 5:72696110-72696132 TCTGGGAGGAAGAGAGAAGAGGG + Intergenic
992986966 5:82240507-82240529 GCTGGGAAGGATAGTGAGGAGGG + Intronic
993271649 5:85804950-85804972 GCTATGAGCAAGACTGAGGAGGG + Intergenic
994048426 5:95335197-95335219 GGAGGGAGGAGGAAGGAGGAAGG - Intergenic
994167838 5:96626447-96626469 GAGGGCAGGAGGAATGAGGATGG - Intronic
994366873 5:98928021-98928043 GCTGGATGGATGAGTGAGGATGG - Intronic
994452107 5:99955915-99955937 CCTGGGAGGAAGAAAGGGGTGGG - Intergenic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
994873826 5:105389417-105389439 GTTGGCAGGAAGCATGAGGGAGG + Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995452690 5:112320132-112320154 ATTGGGTGGAAGAATGAGCAAGG - Intronic
995636414 5:114197673-114197695 GCTGGGAGGCAGAATAGGGGTGG + Intergenic
996184264 5:120457430-120457452 GCTGTGAGGTAGAATGAGTTTGG + Intergenic
996508736 5:124295749-124295771 GGAGAGAGGAAGAATGATGAGGG - Intergenic
996576266 5:124979377-124979399 GATGGGAGGAGGAAGGGGGATGG + Intergenic
996884753 5:128341740-128341762 CCTGGGATGAACAATGAGGAAGG - Intronic
996995627 5:129693298-129693320 GCTGGCATCAAGAATGAGGAAGG - Intronic
997645545 5:135479249-135479271 GCTGGTGGGCAGAATGAGGCAGG - Intergenic
997697713 5:135874511-135874533 ACTGGGAGGAGGAGTGGGGAAGG - Intronic
997735361 5:136209035-136209057 ACTAGGAGGGAGAAAGAGGAAGG - Intergenic
997820468 5:137061569-137061591 GCTGGGAGGTAGGAGCAGGATGG - Intronic
997846015 5:137286586-137286608 CCAGGGAGGCAGAATGAGGGAGG + Intronic
997879761 5:137579159-137579181 GCTGGGAGCCAGTATGGGGAGGG - Intronic
998326131 5:141281478-141281500 GCTGTGAGGAAGAATGTGTTAGG + Intergenic
998394336 5:141808756-141808778 GCCTGGAGGAAGGATGGGGAAGG + Intergenic
998605925 5:143634509-143634531 CCTGGGAAGAAGAACCAGGATGG + Intergenic
998628585 5:143873692-143873714 GTAGGGAGGAAGACTGAAGAGGG - Intergenic
999304147 5:150508976-150508998 GCTGGCAGGAAGACAGAGGCAGG - Intronic
999429588 5:151514691-151514713 GCTGAGAGTGGGAATGAGGAGGG - Intronic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999832432 5:155333295-155333317 GCTGGGAGGAAGTGAGAGGATGG - Intergenic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000174530 5:158737825-158737847 ACTCGGAGGAAGACTGATGAGGG + Intronic
1000364257 5:160476483-160476505 GATGGGAAGATGACTGAGGACGG + Intergenic
1000507251 5:162136567-162136589 GATGGCAGGAAGAATAAAGATGG + Intronic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1001089416 5:168726421-168726443 GCAGGGAGGAAGAGGGAGGCAGG + Intronic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001426097 5:171623691-171623713 GCTGGGGAGAAGACAGAGGAGGG + Intergenic
1001559483 5:172659850-172659872 GCTGGGAGGATGACAAAGGATGG - Intronic
1001754422 5:174157373-174157395 GCTGGGAGCCAGATTGTGGAGGG - Intronic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1003097656 6:3155382-3155404 ACTGGAAGGAAGAAAGAGCAAGG - Intronic
1003101340 6:3178689-3178711 ACTGGAAGGAAGAAAGAGCAAGG - Intergenic
1003238144 6:4316994-4317016 GCAGGGAGGGAGAGTGAGGATGG + Intergenic
1003421076 6:5959146-5959168 GGTGGGAGGAGGGATAAGGAAGG + Intergenic
1003443198 6:6162238-6162260 GCTGGGAGCAGGGATGAGTAAGG - Intronic
1003518482 6:6837173-6837195 GCAGGAAGGAAGAAGGAGGAAGG + Intergenic
1003977642 6:11358882-11358904 GCAGGCAGCAAGAATGAGAAAGG + Intronic
1004097549 6:12573295-12573317 GCTGGGGGGAAAAATGAGGATGG + Intergenic
1004252386 6:14033067-14033089 GCTGGGAGGAACAATCAAAATGG - Intergenic
1004588782 6:17028963-17028985 GGTGGGAGGAAGGATAAAGAGGG - Intergenic
1004939485 6:20540839-20540861 GCTCGGGGGAAGAATGGGGCTGG + Intronic
1005017307 6:21386392-21386414 CCTGGGAGGAAGATTGAGATAGG + Intergenic
1005169665 6:22968515-22968537 GCGGGGAGGAGGACTGAGCAAGG - Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005816242 6:29554876-29554898 GGAGGGAGGAAGATGGAGGAAGG + Intergenic
1005916982 6:30360915-30360937 TCAAGGAGAAAGAATGAGGAAGG + Intergenic
1005949958 6:30624672-30624694 GCTGGGATAAAGATTTAGGAGGG - Intronic
1006243703 6:32710060-32710082 GCTGGGAGGAGGAAGGAATAAGG - Intergenic
1006399257 6:33806936-33806958 GCTGGGAGGAGGACTGCAGATGG + Intergenic
1006602106 6:35233065-35233087 GCTGGGAGGAAAAGGGAGTATGG + Intronic
1006635128 6:35456460-35456482 TCCTGGAGGAAGAAGGAGGAAGG + Intronic
1006802135 6:36766052-36766074 GCTGGGAGGAGGGAGGTGGAGGG + Intronic
1006823881 6:36919556-36919578 TCTGGAGGAAAGAATGAGGAGGG - Exonic
1007209257 6:40178660-40178682 GCAGGGATGAATAATGATGATGG + Intergenic
1007304216 6:40891790-40891812 GCTGTGAGCAAGGATGTGGAGGG + Intergenic
1007380783 6:41488825-41488847 GCTGGGAGGGAGAAAGTGGGAGG + Intergenic
1007386368 6:41522973-41522995 GCGGGAAGGAAGGAGGAGGAGGG - Intergenic
1007407364 6:41642743-41642765 CCGTGGAGGAAAAATGAGGAAGG - Intronic
1007610155 6:43143857-43143879 GCTGGGAGGAGGAAACAGCAGGG - Intronic
1007725130 6:43911487-43911509 GCTGGGAGGAAGGCCAAGGAGGG - Intergenic
1007941378 6:45784834-45784856 GATAGGAGAAAGAAGGAGGAAGG - Intergenic
1008880361 6:56375280-56375302 GCTGGGTGGAGAAGTGAGGAGGG - Intronic
1009038737 6:58151621-58151643 GGTGGGAGGAAAAGTGGGGATGG - Intergenic
1009715070 6:67380684-67380706 GCTGGGAAGTATAATGGGGAGGG + Intergenic
1009766253 6:68079660-68079682 GCTGCTAGGAAGGCTGAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010399090 6:75427987-75428009 GGTTGAAGGAAGAGTGAGGAAGG + Intronic
1011499279 6:87970065-87970087 GCTGGGGGTAATAATGAAGATGG + Intergenic
1011712522 6:90069138-90069160 GATGGGAGGAAGCCTGAAGACGG + Intronic
1011943756 6:92875040-92875062 GCTGTCAGGAAAAATGAGTATGG + Intergenic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1012213916 6:96558158-96558180 GTTGGGAGGGAGTAAGAGGATGG + Intergenic
1012497677 6:99852582-99852604 TCTGGGAGGCAGAGAGAGGAAGG - Intergenic
1012574943 6:100783226-100783248 GCTGGGAAGAACACTGAGTAGGG - Intronic
1012901925 6:105016637-105016659 GCAGAGAGGGAGAATCAGGATGG - Intronic
1013196674 6:107850362-107850384 ACTGGGAGGGGGCATGAGGAAGG - Intergenic
1013837997 6:114355675-114355697 TCTTTGAGGAAGAATGAGAAGGG - Intergenic
1014245221 6:119060782-119060804 GCCAGGAGGAAGAAAGAGAAGGG - Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014648505 6:124005990-124006012 GCTGTAAGGATGAATGAGCAGGG - Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015880477 6:137866649-137866671 GCTGGCAGGAACAATGGAGATGG + Intergenic
1016070554 6:139733389-139733411 GCTAGGAGGAAAAATAAGGCAGG + Intergenic
1016745377 6:147573743-147573765 GCTGGGCAGTAGAATGTGGAGGG + Intronic
1017702491 6:157088963-157088985 GCTGGGAGTAAGAGGAAGGAAGG - Intronic
1017821879 6:158054877-158054899 GCTGGGAGTAAGAAGGAGAATGG + Intronic
1018131775 6:160738690-160738712 GAAGGGAGGAAGAGTGAGAAAGG - Intronic
1018181463 6:161226931-161226953 GCAGGGAAGAAGAAGGAAGAAGG + Intronic
1018396109 6:163379213-163379235 GCTGTGAGGAAGGAAGGGGATGG - Intergenic
1018676185 6:166224131-166224153 GCTGGGTGCAAGACGGAGGAGGG + Intergenic
1018779732 6:167052352-167052374 GCAGGAAGGAAGGAAGAGGAAGG + Exonic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018863826 6:167732378-167732400 GCAGGGAGGAAGCAGGAGGCAGG - Intergenic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1019180792 6:170186388-170186410 CCCGGGAGGAAGACTGAGGGAGG + Intergenic
1019409779 7:901438-901460 GCTGGGGAGAAGCCTGAGGAGGG - Intronic
1019445445 7:1068634-1068656 GTTGGGGGGAAGACTGGGGATGG - Intronic
1019484092 7:1280560-1280582 GGAAGGAGGAAGAAGGAGGAAGG + Intergenic
1019484126 7:1280738-1280760 GGAGGGAGGAAGAAGGAAGAAGG + Intergenic
1019484145 7:1280840-1280862 GGAAGGAGGAAGAAGGAGGAAGG + Intergenic
1019484174 7:1280993-1281015 GGAAGGAGGAAGAAGGAGGAAGG + Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1019964095 7:4484759-4484781 GAGAGGAGGAAGAGTGAGGAGGG + Intergenic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020143535 7:5625264-5625286 GCTGGGGAGAAGGATGGGGAGGG + Intronic
1021450383 7:20778434-20778456 GCTGGGAAGAGGAAAGCGGAGGG + Intergenic
1021623878 7:22573739-22573761 GTTGGGAGGGAAAATGAAGAGGG + Intronic
1021760133 7:23895622-23895644 GCTGTGAGGAAGAATCAGCTTGG + Intergenic
1021800935 7:24305657-24305679 GCTGGGGAGAAGATTGAGGAAGG + Intergenic
1022355649 7:29612105-29612127 GGTTGGAGGAAGAAAGAGAAGGG + Intergenic
1022482752 7:30754529-30754551 GCTGGGCGGATGTATGTGGATGG - Intronic
1022482785 7:30754681-30754703 GGTGGGTGGATGAATGTGGATGG - Intronic
1023411544 7:39893458-39893480 GCTGGGATGAAGGCTGAGGCAGG - Intergenic
1023910663 7:44553352-44553374 GCGAGGAGGAAGAAGGAGGAGGG + Intergenic
1023963230 7:44945180-44945202 ACTGGGAGGAGGAATGGGGGTGG + Intergenic
1024459469 7:49645255-49645277 GCTAGGAGGAAAGATGAGGGAGG + Intergenic
1024699996 7:51896494-51896516 GAAGGGAGGAAGAAAGAAGATGG + Intergenic
1025290094 7:57710978-57711000 GTTGGTTGAAAGAATGAGGAAGG + Intergenic
1026057694 7:66999071-66999093 GCTGGGAGAAAGAATAAAGAAGG - Intronic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026720414 7:72825957-72825979 GCTGGGAGAAAGAATAAAGAAGG + Intronic
1026953822 7:74364426-74364448 GCTGGGGGGGAAAATGGGGAAGG + Intronic
1027223274 7:76227543-76227565 GCTGGGAGGGAGCAGGAGGCAGG - Intronic
1027230211 7:76267926-76267948 GCTGGGGAGAAGATTGAGGGAGG - Intronic
1027231249 7:76274058-76274080 GCAGGGATGAAGGGTGAGGAGGG - Intronic
1027640082 7:80722523-80722545 ACTGGGAGGAAGAATGAGGGAGG - Intergenic
1027969474 7:85060008-85060030 GGTGGGAGGAGGAAAGAGCATGG + Intronic
1028039764 7:86036923-86036945 GCTTGAAGAAAGAATGTGGAAGG - Intergenic
1028519315 7:91712268-91712290 GCTGGAAGGAGGAAGAAGGAAGG + Intronic
1029495565 7:100894255-100894277 GCTGGGAGAAAGAAAGGGAAAGG + Intronic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1029883003 7:103836619-103836641 GCTTGCAGGAAGATAGAGGAGGG - Intronic
1029976155 7:104836169-104836191 GATGGGAAGGAGAATCAGGAAGG + Intronic
1031107196 7:117559166-117559188 GTTTGGAGGAAGAATGGGAAAGG - Intronic
1032332197 7:130990904-130990926 GATGGGAGGAAGGAAGAAGAGGG + Intergenic
1032799587 7:135307462-135307484 GCAGGCAGGGGGAATGAGGAAGG + Intergenic
1032844989 7:135744678-135744700 GCAGAGCGGATGAATGAGGACGG + Intronic
1032870300 7:135977527-135977549 ACTGGGAGGCAGAATGAAGGAGG + Intergenic
1033258699 7:139823561-139823583 GCTAGAGGGAAGAAAGAGGACGG - Intronic
1033442283 7:141390941-141390963 TCTGGTAGGGAGAATGAGGGAGG + Intronic
1033502034 7:141961060-141961082 GGTGGTAGGAATAATGAAGAAGG - Intronic
1033563987 7:142560981-142561003 GCTGGGAGGTAGAAGGAGAAGGG - Intergenic
1034272002 7:149807819-149807841 GGCGGGAGGAAGAATAAAGAAGG - Intergenic
1034293532 7:149950684-149950706 GCTGGGAGGAGGGATGGGGTGGG + Intergenic
1034361612 7:150504443-150504465 TGTGGGATGAGGAATGAGGAAGG + Intergenic
1034563231 7:151894816-151894838 GCGGGGAGGACGAAGGAGCAGGG - Intergenic
1034565283 7:151909448-151909470 GCTCGGAGGAAGAGTGTGTAAGG + Intergenic
1034812534 7:154146169-154146191 GCTGGGAGGAGGGATGGGGTGGG - Intronic
1034941406 7:155232663-155232685 GCTGGGAAGAGGAAGGAGGCAGG + Intergenic
1035357124 7:158282896-158282918 GCTGTGTGGGAGCATGAGGAGGG - Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035759901 8:2061619-2061641 CCTGGGAGGAGGAAGCAGGAGGG - Intronic
1038539790 8:28382708-28382730 GGTGGAAGAAAGCATGAGGAAGG - Intronic
1038978079 8:32723809-32723831 GCTGAAAGGAAGAAAGAAGAAGG + Intronic
1039151475 8:34511728-34511750 GCTGGTTGGAAGAGTGAGGGTGG + Intergenic
1039972866 8:42335169-42335191 GGTGGGAGGAGGAGTGAGCAGGG + Intergenic
1040385889 8:46914781-46914803 ACTGGGAGAAGGAATCAGGAGGG - Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041216822 8:55608881-55608903 GCTGGCAGGAGGAATGGGGAGGG + Intergenic
1041978334 8:63825573-63825595 GCTGGAAATAAGAGTGAGGACGG - Intergenic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042741770 8:72056176-72056198 GGTGGGAGGAAATAAGAGGAGGG - Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042889334 8:73589966-73589988 GAAGGGAAGAAGAAAGAGGAGGG + Intronic
1043428517 8:80171741-80171763 GCCGGGAGGAGGGAAGAGGACGG + Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1045133253 8:99182317-99182339 TTTGGGAGGATGAAGGAGGAAGG + Intronic
1045233088 8:100324824-100324846 GGAGGGAGGAAGAAGGAGGAAGG - Intronic
1045661891 8:104446651-104446673 GCAGAGAGGAATAATGAGAAGGG - Intronic
1046109227 8:109701850-109701872 GCTGGGAGAGAGAATTAGAAAGG + Intergenic
1046905436 8:119567279-119567301 GATGGATGGATGAATGAGGATGG + Intronic
1047416207 8:124666710-124666732 GGGTGGAGGGAGAATGAGGAGGG + Intronic
1047426572 8:124751996-124752018 GTAGGGAGGAAGAAAGAGGCCGG + Intergenic
1047858134 8:128935243-128935265 GCTGAGCGGAAGAATGAGAATGG + Intergenic
1047875524 8:129132997-129133019 ACTGGGTGGAAAAATGAGAATGG - Intergenic
1048846015 8:138604301-138604323 GCTGGGTAGAAGACTGTGGAGGG + Intronic
1049316634 8:141972619-141972641 GCTGGGAGGAAGGCAGAGCAGGG + Intergenic
1049402063 8:142432811-142432833 GCTGGGAGGAGGGCTGGGGAGGG - Intergenic
1049443560 8:142619873-142619895 GCAGGAAGGAGGAAGGAGGAAGG - Intergenic
1050218444 9:3357583-3357605 GCTGGGAAGGGAAATGAGGAAGG + Intronic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1051038355 9:12776155-12776177 GCTGGGTGGAGGAATGAGCAGGG + Intronic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1051589156 9:18758573-18758595 AGTGGGAGGAAGATGGAGGAAGG - Intronic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052070850 9:24080071-24080093 GCTGCAAGAGAGAATGAGGAAGG - Intergenic
1052263809 9:26548648-26548670 ACTGGGGGAAAGAATGAGGTAGG - Intergenic
1053301137 9:36950476-36950498 CTTGGGAGGAAGACTGAGGAGGG - Intronic
1053532012 9:38891810-38891832 GCTGGATGAAAGAATGAGGTTGG + Intergenic
1054166332 9:61734428-61734450 GATGGTTGAAAGAATGAGGAAGG - Intergenic
1054204237 9:62116219-62116241 GCTGGATGAAAGAATGAGGTTGG + Intergenic
1054634126 9:67472145-67472167 GCTGGATGAAAGAATGAGGTTGG - Intergenic
1054869989 9:70040353-70040375 GCAGGGAAAAAGACTGAGGAGGG - Intergenic
1055379382 9:75689498-75689520 AGTGGGAGGAAGAATAAGGAGGG + Intergenic
1055393811 9:75851960-75851982 GTTGGGGGGAAGAAAGGGGAGGG - Intergenic
1055555684 9:77471124-77471146 TCTGGGAGTAAGAATGTGAAGGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056507939 9:87275247-87275269 GCTGGGAGGAGGAATGGAGGGGG - Intergenic
1056557173 9:87699244-87699266 GCTGGGAGGTAGAAAGAAGGGGG - Intronic
1057087491 9:92224943-92224965 ACTGGGAGGAAGAATAACCACGG + Intronic
1058090814 9:100803588-100803610 GCAGAGAGGAAGAACGTGGAAGG - Intergenic
1058499359 9:105594632-105594654 GCTGCTAGGAAGACTGAGGTAGG + Intronic
1058694490 9:107547879-107547901 GCTGTAAGGAGGAAGGAGGAAGG + Intergenic
1059248361 9:112867013-112867035 GGTGGGAGGAATTCTGAGGAGGG - Intronic
1059369591 9:113816608-113816630 GATGGGAGGAAAAATGAATAAGG + Intergenic
1060446165 9:123690101-123690123 GGAGGGAGGAAGAAAAAGGAGGG + Intronic
1061008991 9:127944280-127944302 GCTGGGAGGAAGTAGAAGGGAGG + Intronic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061870302 9:133516834-133516856 CCCGGGAGGAAGAAGGAGGGAGG - Intronic
1062113339 9:134794756-134794778 GGAGGGAGGAAGGAGGAGGAGGG + Intronic
1062176728 9:135167560-135167582 GATGACAGGAAGAATGAAGAAGG + Intergenic
1185918102 X:4058716-4058738 GGTGGGAGGAAGAAAGAGGGAGG + Intergenic
1186239965 X:7555307-7555329 GAAGGGAGGAAGGAGGAGGAAGG + Intergenic
1186462525 X:9759738-9759760 GTTCTGAGGAAGAATGAGTACGG + Intronic
1186758726 X:12700921-12700943 GCAGGGAGGCAGAATTAGCACGG - Intronic
1186868672 X:13747661-13747683 GGTAGGTGGAAGAATGAGGATGG + Intronic
1186953969 X:14659681-14659703 CCTGGGAGAAAGAAGGAGAAAGG + Intronic
1187591437 X:20721544-20721566 GGAGGGAGGAGGAAGGAGGAAGG - Intergenic
1188144613 X:26595645-26595667 GTTAGGAGGGAGGATGAGGAGGG + Intergenic
1188599936 X:31950021-31950043 GCTCGAAGGAAGCATAAGGAAGG - Intronic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1189178695 X:38982866-38982888 GATGGAAGGAGGAGTGAGGAGGG + Intergenic
1189760193 X:44314402-44314424 GCAGCCTGGAAGAATGAGGAAGG + Intronic
1190025043 X:46914212-46914234 GCTGGGAGGGGGAAAGAGTAGGG + Intronic
1190141662 X:47851736-47851758 GCAATGAGGAACAATGAGGAAGG - Intronic
1190154106 X:47973726-47973748 GATTGGAGGAAGAGAGAGGAGGG - Intronic
1190466651 X:50731290-50731312 GCTGGGTGGAAGAAGGAGAGAGG - Intronic
1190509657 X:51162584-51162606 GCAGGGAGGAAGGAGGAGGATGG - Intergenic
1190932095 X:54957538-54957560 GATGGGAGGATGAAGAAGGAAGG + Intronic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1192235678 X:69294120-69294142 GCTGGGAGGAGCAGTGTGGAAGG + Intergenic
1192434271 X:71133225-71133247 GCTGGGGAGAAGAAGGAAGAGGG + Intronic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1192493651 X:71598433-71598455 GCTGGAAGGAAGAATGAGCCAGG - Intronic
1195000918 X:100642521-100642543 GCTAGGAGGAAGTCAGAGGAGGG - Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1195937902 X:110142884-110142906 GCTGGGAGGCAGGGTGAGGCAGG + Intronic
1196058100 X:111377779-111377801 GGAGGAAGGAAGAAGGAGGAAGG - Intronic
1196322452 X:114357346-114357368 GCTGGGAGGAAAGGTGGGGATGG + Intergenic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1197650630 X:129059940-129059962 GGTGGGAGGTAGCATGAGAAAGG - Intergenic
1198014876 X:132600175-132600197 TCTGTGAGGAAGAGTGAGGCGGG + Intergenic
1198111963 X:133509750-133509772 AGTGGCAGGAGGAATGAGGAGGG + Intergenic
1198152135 X:133921898-133921920 GCGGGGAGAAAGAAGTAGGATGG - Intronic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1198730396 X:139721873-139721895 GCAGGGAGGAGAAATGAGAAAGG - Intergenic
1199596055 X:149506609-149506631 GCTGGGAGGAGGAAGGGAGATGG + Intronic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1200126531 X:153817745-153817767 GCAGTGAGGAAGACCGAGGAAGG + Intronic
1200685170 Y:6251604-6251626 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1200990696 Y:9342874-9342896 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1200993356 Y:9363188-9363210 GCTGGGGAGAACAATGAGAAAGG - Intronic
1200996018 Y:9383462-9383484 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1201001189 Y:9472341-9472363 GCTGGGGAGAACAATGAGAAAGG - Intronic
1201003853 Y:9492672-9492694 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1201006507 Y:9512953-9512975 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1201009163 Y:9533259-9533281 GCTGGGGAGAACAATGAGAAAGG - Intergenic
1201222365 Y:11784207-11784229 GCAGGGAGGAAAAGGGAGGAGGG + Intergenic
1201740999 Y:17324964-17324986 GGAGGGAGGGAGTATGAGGAAGG + Intergenic