ID: 1002417039

View in Genome Browser
Species Human (GRCh38)
Location 5:179126130-179126152
Sequence CCGTCGAGCTCTCTGCCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002417039_1002417059 25 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417059 5:179126178-179126200 CCGAGGGTGCAAGGAGGGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 264
1002417039_1002417049 9 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417049 5:179126162-179126184 GGGCAGCATGCCCTGCCCGAGGG 0: 1
1: 0
2: 1
3: 14
4: 175
1002417039_1002417057 24 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417057 5:179126177-179126199 CCCGAGGGTGCAAGGAGGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 313
1002417039_1002417050 16 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417050 5:179126169-179126191 ATGCCCTGCCCGAGGGTGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 150
1002417039_1002417054 20 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417054 5:179126173-179126195 CCTGCCCGAGGGTGCAAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1002417039_1002417052 19 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417052 5:179126172-179126194 CCCTGCCCGAGGGTGCAAGGAGG 0: 1
1: 0
2: 4
3: 24
4: 198
1002417039_1002417048 8 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417048 5:179126161-179126183 GGGGCAGCATGCCCTGCCCGAGG 0: 1
1: 1
2: 3
3: 26
4: 275
1002417039_1002417055 21 Left 1002417039 5:179126130-179126152 CCTGAAGGCAGAGAGCTCGACGG 0: 1
1: 0
2: 2
3: 11
4: 86
Right 1002417055 5:179126174-179126196 CTGCCCGAGGGTGCAAGGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002417039 Original CRISPR CCGTCGAGCTCTCTGCCTTC AGG (reversed) Exonic
900314342 1:2049702-2049724 CCGCCCAGCTCCCTGCCTCCTGG - Intergenic
900858664 1:5207270-5207292 CAGTCAGGCTCTCTTCCTTCTGG - Intergenic
903950852 1:26994977-26994999 CCGCCCAGCTCCGTGCCTTCGGG + Intronic
906308999 1:44739668-44739690 CCCCCGAGCGCTGTGCCTTCTGG - Intergenic
907249913 1:53131192-53131214 CCGTCCAGCTCTCCACCTTCTGG - Intronic
908605424 1:65792831-65792853 CCGGCGAGCTGTCTCTCTTCCGG + Intronic
910647068 1:89525209-89525231 TCGTTGTGCTCCCTGCCTTCGGG + Intronic
915167609 1:153957354-153957376 CCTTCTAGCTCTCTGCCATGAGG + Intronic
915729042 1:158039829-158039851 CAGACAAGCTCTCTCCCTTCTGG - Intronic
920461383 1:206143335-206143357 CTGCCCAGCTCTCTGCCTCCAGG - Intergenic
1074442059 10:113486663-113486685 CCTTCGTGCTCTCTGCCTTCTGG - Intergenic
1075047821 10:119159852-119159874 CCTTTGAGGTCTGTGCCTTCTGG - Intronic
1075650754 10:124127306-124127328 TGGTCTAGCTCTCTGCCTCCTGG + Intergenic
1076042529 10:127262924-127262946 CCGCCCAGCTCTCTGTCTTTTGG - Intronic
1076125010 10:127967053-127967075 CCGTCCTGCTCTCTGCCATCCGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085294822 11:75425464-75425486 CCGCCGAGCTCACGGCCTCCGGG + Exonic
1089528021 11:119109431-119109453 CCGTCCTGCTATCTGCCTTGAGG + Intronic
1096157241 12:49347461-49347483 CCGTGGATGTCTCTGCCTTAAGG + Exonic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104904318 12:132205286-132205308 CCCCCGGACTCTCTGCCTTCAGG + Intronic
1105284658 13:18994305-18994327 CCTTCTGGCTTTCTGCCTTCTGG - Intergenic
1105284977 13:18996197-18996219 CCCTCTGGCCCTCTGCCTTCTGG - Intergenic
1113594346 13:111520753-111520775 CCGTCCACCTCTGTGCCTGCAGG + Intergenic
1115091725 14:29585025-29585047 CCTTCAAGCTCCTTGCCTTCAGG + Intronic
1115192560 14:30761248-30761270 CTGTTGGTCTCTCTGCCTTCTGG - Intergenic
1116719023 14:48469262-48469284 CAGTCCAGCTCTCTGACCTCTGG + Intergenic
1121738361 14:96234455-96234477 CCACGGAGCTCTTTGCCTTCCGG - Intronic
1130060265 15:80564464-80564486 CTGTCCAGCTCTGTGACTTCTGG - Intronic
1132497020 16:268717-268739 GCCTCGAGGTCACTGCCTTCCGG - Exonic
1141503927 16:84462527-84462549 CAGCCCAGCTCCCTGCCTTCAGG - Intronic
1142584789 17:965301-965323 GAGTCCAGCTCTCTGCCATCTGG - Intronic
1147109909 17:38254253-38254275 ACTGCAAGCTCTCTGCCTTCCGG - Intergenic
1148690198 17:49522739-49522761 CTGTCCAGCCCTCTGCCTCCTGG - Intergenic
1149476089 17:56962174-56962196 CCGTGGTGCACTCTGCCTCCCGG + Intergenic
1150843409 17:68631161-68631183 CCCTTGTGATCTCTGCCTTCTGG + Intergenic
1152758157 17:82095712-82095734 CCGCCGAGCTCTCTGCTCTGCGG - Intronic
1161593442 19:5139343-5139365 CCGCCGATGTCTCTGCCTTCAGG + Intronic
1165403288 19:35615270-35615292 GCGTCGAGCTCTCCTCCTCCGGG + Exonic
1167880521 19:52453779-52453801 TCCCTGAGCTCTCTGCCTTCGGG + Intronic
924962678 2:47524-47546 CTGTCGCCCTCCCTGCCTTCCGG - Intergenic
925015661 2:522425-522447 CCGTCGAGTTCTGTGCCCTCAGG - Intergenic
925340278 2:3131183-3131205 CCTTCAAGCTCTCTCCCTCCAGG - Intergenic
927935042 2:27071642-27071664 CGGTCCAGGTCTCTGACTTCGGG - Exonic
928281785 2:29952888-29952910 TGGTCAAGCTCTCTGCCTCCAGG - Intergenic
932412579 2:71555994-71556016 CCGTGGAGCACTGCGCCTTCAGG - Exonic
932447161 2:71787984-71788006 CCCTCTATCTCCCTGCCTTCAGG + Intergenic
937055480 2:118931731-118931753 CATTCTAGCTCTCTGTCTTCTGG + Intergenic
938812875 2:134869930-134869952 CCATCCATCTCTCTGCCTTCAGG + Intronic
939730359 2:145777121-145777143 GCGTGGAGCACTCTGCCTACAGG + Intergenic
940524327 2:154792689-154792711 CCATAGATCTCTCTGCCTTTGGG - Intronic
945039365 2:205731163-205731185 CAGATGAGCTCTCTGCCTTGTGG - Intronic
946673988 2:222137861-222137883 CCGTACAGCTCTCTGCTTTTTGG + Intergenic
947876373 2:233470583-233470605 CAGGCGAGCTCCCTGCCCTCTGG - Exonic
948595580 2:239077259-239077281 CCATCGGGCTCTGTTCCTTCGGG + Intronic
1168942613 20:1726378-1726400 TCGTAGAGCTCTGTGCCTCCAGG + Intergenic
1173226448 20:41165037-41165059 CCGTGGAGATCTCTGCCGACGGG + Exonic
1175371405 20:58495527-58495549 CAGTCGAGGTCCCTGCCCTCGGG - Intronic
1176871018 21:14083554-14083576 CCATCCACCTCTCTGCTTTCGGG - Intergenic
1177412696 21:20750676-20750698 TCCTCAAGCTCTGTGCCTTCTGG - Intergenic
1179770248 21:43609938-43609960 CCCTGGAGCTCTGTGCCTTTGGG - Intronic
1182075428 22:27492354-27492376 CCGGCCAGCTCTCTGACTTCAGG - Intergenic
1182423806 22:30261441-30261463 CCCTGGAGCTCTGTGCCTTCAGG + Intergenic
1183332422 22:37228703-37228725 CCCCCCAGCTCTGTGCCTTCGGG - Intronic
1183911325 22:41081677-41081699 CAGTCAACCTCTCTGTCTTCTGG - Intergenic
1183955864 22:41380610-41380632 AAGCCAAGCTCTCTGCCTTCCGG + Intronic
1184265004 22:43342226-43342248 CCCTCCTGCTCTCTGTCTTCAGG - Intronic
1184456953 22:44616299-44616321 CCTTGGAGCCCTCTCCCTTCTGG + Intergenic
953718800 3:45337491-45337513 CAGTCTATCCCTCTGCCTTCTGG - Intergenic
955724668 3:61920243-61920265 CTTTCCAGCTCTGTGCCTTCTGG + Intronic
959663603 3:108897013-108897035 CTGTCCAGCTCTCTGCCTTCTGG + Intergenic
963811428 3:149780578-149780600 CAGTTGAGTTCTCTGCCTTCTGG + Intronic
970586967 4:17523597-17523619 ACTTCCAGCTCTCTGTCTTCTGG - Intronic
972817368 4:42658251-42658273 CTCTCCAGCTCTCTCCCTTCAGG - Intergenic
981617333 4:146655334-146655356 CCATCGACCTCGCTGCCTTCTGG + Intergenic
982179401 4:152735636-152735658 CAGTCCATCTCTCTGCCTTTAGG + Intronic
985790770 5:1925942-1925964 CCCTGGAGCTCTGTGCCTTCTGG + Intergenic
993079429 5:83277228-83277250 ATTTCCAGCTCTCTGCCTTCTGG + Intronic
998254343 5:140573364-140573386 CTGTCATTCTCTCTGCCTTCAGG + Intronic
1002417039 5:179126130-179126152 CCGTCGAGCTCTCTGCCTTCAGG - Exonic
1002990428 6:2233351-2233373 CTGTAGAGCTCTCTTCCTTAGGG - Intronic
1006364413 6:33606956-33606978 CTTTCCAGCTCTCTCCCTTCAGG - Intergenic
1020315206 7:6900876-6900898 CTGTCGAGGGCTCTGCCCTCGGG + Intergenic
1020552462 7:9624302-9624324 CCCTCTAGCTTTCTGCTTTCAGG - Intergenic
1020757507 7:12221800-12221822 CTCTCCAGCTCTCTACCTTCTGG - Intronic
1025829615 7:65038181-65038203 CCGTCCAGCTCACTCCTTTCGGG + Intergenic
1030504015 7:110396988-110397010 CCGTCAACCACTTTGCCTTCAGG - Intergenic
1035449896 7:158970374-158970396 CCATCCAGCTCCCTGCCCTCTGG - Intergenic
1038147861 8:24914576-24914598 CCGTCGAGATGTCTGTCTTCAGG - Exonic
1044699149 8:94950069-94950091 CTGCTGACCTCTCTGCCTTCAGG - Intronic
1045054263 8:98355794-98355816 CTTTCCAGCTCTCTGCTTTCTGG + Intergenic
1050433187 9:5583138-5583160 CCCTTGAGTTTTCTGCCTTCAGG - Intergenic
1052403119 9:28025767-28025789 TTGTCTGGCTCTCTGCCTTCTGG - Intronic
1053418912 9:37964513-37964535 CCGTAGAGGCCTCTGCGTTCGGG - Intronic
1059449714 9:114362713-114362735 TGGTCAAGCTCTCTGCCATCAGG + Intronic
1060224608 9:121783309-121783331 CCGCCCAGATCTCTGGCTTCTGG - Intronic
1060565821 9:124590672-124590694 TTGTCAACCTCTCTGCCTTCTGG - Intronic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1192744266 X:73923069-73923091 CTGAAGAGCTCTATGCCTTCAGG - Intergenic
1194975625 X:100393688-100393710 CCTTGGCGGTCTCTGCCTTCTGG - Intronic