ID: 1002417830

View in Genome Browser
Species Human (GRCh38)
Location 5:179130019-179130041
Sequence GGCAATGAAGGTTTTGGAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002417824_1002417830 -8 Left 1002417824 5:179130004-179130026 CCACTCCACGCCCATGGCAATGA 0: 1
1: 0
2: 4
3: 10
4: 156
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184
1002417818_1002417830 17 Left 1002417818 5:179129979-179130001 CCCGGCCGTCCTCGTCTCTGTAC 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184
1002417823_1002417830 -7 Left 1002417823 5:179130003-179130025 CCCACTCCACGCCCATGGCAATG 0: 1
1: 0
2: 3
3: 10
4: 114
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184
1002417819_1002417830 16 Left 1002417819 5:179129980-179130002 CCGGCCGTCCTCGTCTCTGTACT 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184
1002417820_1002417830 12 Left 1002417820 5:179129984-179130006 CCGTCCTCGTCTCTGTACTCCCA 0: 1
1: 0
2: 1
3: 24
4: 343
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184
1002417821_1002417830 8 Left 1002417821 5:179129988-179130010 CCTCGTCTCTGTACTCCCACTCC 0: 1
1: 0
2: 0
3: 24
4: 287
Right 1002417830 5:179130019-179130041 GGCAATGAAGGTTTTGGAACTGG 0: 1
1: 0
2: 1
3: 28
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002417830 Original CRISPR GGCAATGAAGGTTTTGGAAC TGG Exonic