ID: 1002418445

View in Genome Browser
Species Human (GRCh38)
Location 5:179132932-179132954
Sequence ACGTCCTGCTAGTAGAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002418441_1002418445 15 Left 1002418441 5:179132894-179132916 CCACCTTCTGTTGGGGGAGGAGG 0: 1
1: 0
2: 4
3: 28
4: 264
Right 1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 91
1002418434_1002418445 25 Left 1002418434 5:179132884-179132906 CCGTCACAGCCCACCTTCTGTTG 0: 1
1: 1
2: 1
3: 26
4: 257
Right 1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 91
1002418443_1002418445 12 Left 1002418443 5:179132897-179132919 CCTTCTGTTGGGGGAGGAGGCAG 0: 1
1: 0
2: 1
3: 42
4: 440
Right 1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 91
1002418440_1002418445 16 Left 1002418440 5:179132893-179132915 CCCACCTTCTGTTGGGGGAGGAG 0: 1
1: 0
2: 3
3: 19
4: 166
Right 1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG 0: 1
1: 0
2: 2
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002418445 Original CRISPR ACGTCCTGCTAGTAGAGTCA GGG Intronic
901634559 1:10664524-10664546 ACGTCCTGCTGGGAGGGCCAGGG + Intronic
904275675 1:29382702-29382724 CAGTCCTTCTAGTTGAGTCACGG - Intergenic
905319394 1:37105186-37105208 AAGTCATGCTGGCAGAGTCAGGG + Intergenic
905547610 1:38811946-38811968 ATGTCCTGCAAGGGGAGTCAGGG + Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
915066658 1:153230666-153230688 AGGACCTGCTACTAGAGTTATGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919384048 1:196897168-196897190 ACGTCCTGCGAGGGGAATCAGGG - Intronic
1064829822 10:19450377-19450399 ACATCCTGCTAGGAAAGTTAAGG + Exonic
1065011669 10:21426832-21426854 ACGTCCTGCGAGGAGGGTCAGGG - Intergenic
1070285124 10:75077432-75077454 ATGTCCAGCTAGTAGAGACGGGG + Intergenic
1071490195 10:86130992-86131014 ACGTCCTGCGAGTGGGGTCAGGG + Intronic
1074965413 10:118487022-118487044 ACGTCCTGCGAGAGGAATCAAGG - Intergenic
1076586490 10:131551923-131551945 ATGTCTGGCTAGTAGAGTCTTGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1089448958 11:118577572-118577594 ACTTCCAGCTGGTACAGTCAGGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091877075 12:3944202-3944224 ATGTCCTGCTACTATAGTTAGGG - Intergenic
1094596708 12:31872861-31872883 ACGTCCTGCAAGGGGAATCAGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1108254725 13:48598963-48598985 ACGTCCTGCAAGGGGGGTCAGGG + Intergenic
1114260718 14:21034289-21034311 TCCTCCTGCTGGTAGAGTTAAGG + Exonic
1115684393 14:35779947-35779969 ACGCCCAGCTAGTAGAGACAGGG - Intronic
1116844236 14:49850258-49850280 ACGCCTGGCTAGTAGAGACAGGG + Intronic
1122203991 14:100139190-100139212 ACGTCCTGCTGGTGGAGCAAAGG + Intronic
1124944818 15:34254894-34254916 AAGTAGTGATAGTAGAGTCAGGG - Intronic
1130772864 15:86942372-86942394 ACTTCCCGACAGTAGAGTCAGGG - Intronic
1131443389 15:92475737-92475759 ACCTCCTGCAAGTAGAGTTCCGG - Intronic
1132620566 16:866249-866271 ACCTCATGCTGGTAGAGACAGGG + Intronic
1133639086 16:7699453-7699475 AAGTCCTGCGAGTACAGGCACGG + Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1135316090 16:21445551-21445573 AAGTTCTTCTAGTAGAGACAGGG + Intronic
1135369015 16:21877813-21877835 AAGTTCTTCTAGTAGAGACAGGG + Intronic
1135442801 16:22493330-22493352 AAGTTCTTCTAGTAGAGACAGGG - Intronic
1136326202 16:29526038-29526060 AAGTTCTTCTAGTAGAGACAGGG + Intergenic
1136440891 16:30266022-30266044 AAGTTCTTCTAGTAGAGACAGGG + Intergenic
1141700328 16:85639334-85639356 AGGTCCTGGTAGGAGAGGCAGGG - Intronic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1157888505 18:51392068-51392090 ACGTCTTGCGAGCTGAGTCAGGG + Intergenic
1159611682 18:70532882-70532904 ACGTCCTGCGAGGAGAATCAGGG - Intergenic
929785985 2:44991627-44991649 CCATCCTGGTAGGAGAGTCATGG + Intergenic
929845491 2:45521137-45521159 ACGTCCTGCAAGGGGAGTCAGGG + Intronic
936885970 2:117310331-117310353 ACATCCTGCAAGGAGAATCAGGG - Intergenic
939778768 2:146418517-146418539 ACGTGCTGGAAGTAGAGACACGG - Intergenic
945323008 2:208448474-208448496 ACGCCCGGCTAGTAGAGACGGGG - Intronic
947667327 2:231914490-231914512 GTGTCCTGCTTGTACAGTCAAGG - Intergenic
1168824597 20:801348-801370 ATGTCCTGCAAGGAGAATCAGGG + Intergenic
1169978185 20:11353761-11353783 AGGTCCTGCGAGGAGAATCAGGG + Intergenic
1171356434 20:24549446-24549468 ACGTCCTGCAAGGGGAATCAGGG - Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173675061 20:44826475-44826497 TTGTCCTGCTAGTGAAGTCATGG - Intergenic
1174150466 20:48482787-48482809 ACGCCCGGCTAGTAGAGACGGGG + Intergenic
1174923104 20:54726114-54726136 AGGTTCTGCTTGTAGAGTAAGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953521766 3:43649780-43649802 ACGTCCTGCAAGGGGGGTCAGGG - Intronic
957883602 3:86254555-86254577 ACGACCTGCAAGTGGGGTCAGGG - Intergenic
959376361 3:105593384-105593406 ACGTCCTGCTAGGAGAATCAGGG - Intergenic
960359728 3:116697253-116697275 ACGTCCTGCGAGGAGAGTCATGG - Intronic
966291027 3:178359901-178359923 ACTTCCTGCCAGCAGACTCAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
972852796 4:43071304-43071326 ACGTCCTGTTAGGGGAGTCAGGG + Intergenic
974024875 4:56724820-56724842 TCATCCTGTTAGTAGAGACAGGG + Intergenic
976890319 4:90039233-90039255 ACGTCCTGCAAGGGGAATCAGGG - Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
982679483 4:158411533-158411555 ACCTCCTGCTAGTATACTTACGG - Intronic
988931511 5:36039913-36039935 AAGGCCTGATAGTAGGGTCAGGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993773607 5:91962856-91962878 ACATCCTGCAACTGGAGTCAGGG + Intergenic
994007734 5:94859738-94859760 ACGTGATGTTAGTAGAGTGATGG - Intronic
996627418 5:125586609-125586631 ACGTCCTGCGAGAGGAATCAGGG + Intergenic
1002418445 5:179132932-179132954 ACGTCCTGCTAGTAGAGTCAGGG + Intronic
1023335919 7:39170008-39170030 ACGCCCGGCTAGTAGAAACAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1035370420 7:158376241-158376263 ACGTCCTGCATGCAGGGTCAGGG + Intronic
1045031135 8:98137458-98137480 AGGCCCAGCTAGTAGAGACAGGG + Intronic
1048535965 8:135294861-135294883 ACGGCCTCTTAGTGGAGTCAGGG + Intergenic
1050274443 9:3982176-3982198 ACCTCCTGCTGGTAGAGGAAGGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1055486354 9:76759977-76759999 ACGTCCTGCGAGGGCAGTCAGGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1055999137 9:82195092-82195114 ACGTCCTGCGAGGAGGATCAGGG + Intergenic
1056921076 9:90789652-90789674 GTGCCCTGCTAGTAGAGTCAGGG + Intergenic
1057578777 9:96266870-96266892 ACCTCCTGCCTGTAGAGTGAAGG - Intronic
1058326711 9:103707429-103707451 ACTTCCTGCCAGTAGAATCTTGG + Intergenic
1058544496 9:106046139-106046161 CTATCCTGCTAGCAGAGTCATGG - Intergenic
1060003833 9:119982190-119982212 TGGTCCTGCTAGTAAAGGCAAGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1192113966 X:68393187-68393209 ATGTCCTGCAAGTGGGGTCAGGG + Intronic
1194752224 X:97697582-97697604 ACATCCTGCAAGCAGAGCCAGGG + Intergenic