ID: 1002420713

View in Genome Browser
Species Human (GRCh38)
Location 5:179147448-179147470
Sequence CTTTAAACACAGATCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002420713 Original CRISPR CTTTAAACACAGATCCAACA TGG (reversed) Intronic
902889400 1:19431001-19431023 TTTAAAACACAGAATCAACAGGG + Intronic
903767166 1:25742284-25742306 CTCTAAAGCCAGATCCAACTTGG - Intronic
906685424 1:47760239-47760261 CTTTAAACACAGCTCAAATCTGG - Intergenic
909225318 1:73013075-73013097 TTTTAAACACCACTCCAACAAGG + Intergenic
909569425 1:77091489-77091511 CTTGAAAGAGAGAGCCAACAAGG - Exonic
910818806 1:91323104-91323126 CTTTGAACAAAGATCCAAATCGG - Exonic
913056328 1:115164616-115164638 GTTGAATCACAGATTCAACAGGG + Intergenic
916135758 1:161652116-161652138 ATTAAACCACAGATCCAAGAAGG - Intronic
916482479 1:165227240-165227262 TTTAAAACACAGAGCCAACCAGG + Intronic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
917528959 1:175815732-175815754 CTTTAATCAGAGATGCCACAGGG + Intergenic
918582833 1:186152083-186152105 CTTTAAACCAAGATCCAATTAGG + Intronic
922054270 1:222025340-222025362 CCTTGAACACAGAACCAAAATGG - Intergenic
923283950 1:232472805-232472827 TTTTAAACTCAGATACAAAAAGG + Intronic
924501981 1:244646271-244646293 GATTAAACAAAGATACAACAGGG - Intergenic
1063341604 10:5270574-5270596 CTTAAAACACACATCCAGCCTGG - Intergenic
1063709089 10:8459762-8459784 CTTTAAACACAAATCCTCTAAGG + Intergenic
1068174801 10:53444529-53444551 ATTTAAACACAGATCTAATCAGG - Intergenic
1068854898 10:61787560-61787582 CCTAAAACACATATCCAAGAGGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1071483052 10:86079282-86079304 CTTTGAACACAGTTCCGAAAAGG + Intronic
1072490411 10:95900144-95900166 CTTTCACCACAGATCCCACCTGG + Intronic
1072493866 10:95935299-95935321 CTTTGAAGGCAGAACCAACAGGG - Intronic
1073032337 10:100536572-100536594 CTTTAAGCCGAGGTCCAACAGGG + Exonic
1073148385 10:101295180-101295202 CTCTAATCAGAGATCAAACAGGG - Intergenic
1073342199 10:102754040-102754062 CATCAAACACAGAAACAACAAGG + Intronic
1074051715 10:109886732-109886754 CTGTAAATACTGATGCAACAGGG + Intronic
1074458112 10:113613025-113613047 CTTTAAACACAGCTCCTCCAAGG - Intronic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1077844477 11:6010516-6010538 CTTTTAACACTGTTCTAACATGG - Intergenic
1080953129 11:37059931-37059953 CTTTAAAAACATTTCTAACAGGG - Intergenic
1081394510 11:42569723-42569745 CTGTAAACAAAGCTCCAGCATGG + Intergenic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1089020386 11:115208159-115208181 CTCTAAACTCAGCTCCAACCAGG - Intronic
1090260190 11:125313948-125313970 CTTTACACACAGAACTCACAGGG - Intronic
1090601096 11:128372292-128372314 TTTTAATTACAGATCCTACATGG + Intergenic
1090616398 11:128519513-128519535 CTTTAAACACATGTCCTATATGG + Intronic
1091526864 12:1311168-1311190 CTTTAAAAACAGATACACCAGGG + Intronic
1093187602 12:16039045-16039067 CTTTAAACACAGAACATAGAAGG - Intergenic
1096687222 12:53296166-53296188 CGTTAAAGAGAGTTCCAACAGGG - Intronic
1098634609 12:72766579-72766601 CTTTAAACACAGGTCCTGAATGG + Intergenic
1101070957 12:101075374-101075396 CTCTAAATCCAGATCCAACCAGG - Intronic
1101359971 12:104017194-104017216 CTTTAAACACATATACAATTAGG - Intronic
1102797611 12:115702465-115702487 GTTTAAACAAAGATCCATGAGGG + Intergenic
1103813294 12:123633277-123633299 TTTTAATGACAGATCCAACAAGG + Intronic
1105590024 13:21784096-21784118 CACTGAACACAGATCCCACATGG - Intergenic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1108135764 13:47356800-47356822 CTTCAAAAACAGTTCTAACAGGG - Intergenic
1110299051 13:73904064-73904086 TTTTAAAGACAAATACAACATGG + Intronic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1116752640 14:48905888-48905910 GTTTAGACACATATCCACCATGG - Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119271636 14:73310779-73310801 CTTTAAAAAGAGATCTAATAGGG + Intronic
1120238755 14:81924968-81924990 AATTAAACACAGATGCCACATGG + Intergenic
1123459561 15:20457231-20457253 CTGAAATCACAGATCCAACGTGG + Intergenic
1123658500 15:22543190-22543212 CTGAAATCACAGATCCAACGTGG - Intergenic
1124129763 15:26972997-26973019 CTCTAAACAGAGATACAACCAGG - Intronic
1124312365 15:28637682-28637704 CTGAAATCACAGATCCAACGTGG - Intergenic
1125368453 15:38944237-38944259 CTTTAAACAAATATCTAAGATGG - Intergenic
1129131248 15:73498814-73498836 TTTTATACACATATGCAACAAGG - Intronic
1138845928 16:60566031-60566053 CTTAAAAGAAATATCCAACATGG - Intergenic
1139127467 16:64096581-64096603 CTTTCAACACAAATCTAATAAGG + Intergenic
1140706066 16:77631466-77631488 CATTAGTCACAGAACCAACAAGG - Intergenic
1141082743 16:81067200-81067222 ATTTAAAGACAGATACAAAAAGG + Intronic
1143232420 17:5368076-5368098 CTTTAAACATAGCTACAACTAGG + Intronic
1149408553 17:56380291-56380313 CTTTAGAAACAGAGCCAAGATGG + Intronic
1150610938 17:66732600-66732622 CATTAAACTCAGTTACAACACGG + Intronic
1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG + Intergenic
1154269711 18:12908643-12908665 CTTTAAACACAGACACAAAGTGG - Intronic
1155501552 18:26491843-26491865 CTTAGAACACAGTTCCAAAAGGG + Intronic
1156229171 18:35137356-35137378 CTTTCCAAACACATCCAACAAGG - Intronic
1164442449 19:28289639-28289661 TTCTAAACAGTGATCCAACATGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926254476 2:11178296-11178318 ATTGTAACACAGATACAACAGGG + Exonic
926973374 2:18488895-18488917 TTTTAAAAACAGATTAAACAGGG - Intergenic
926988185 2:18646918-18646940 ATTTAAACACAAAACCAGCATGG - Intergenic
927365068 2:22285473-22285495 CTATAACCACAGATAAAACAGGG + Intergenic
927385510 2:22528957-22528979 ATTTAGACACAGTACCAACAGGG + Intergenic
928129109 2:28636663-28636685 CTTTAAACAAAAATCAAGCAGGG + Intronic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
930697246 2:54424519-54424541 CTTGAGACACATATCCCACAGGG + Intergenic
931198101 2:60072349-60072371 CTTTCAACAAACATCCATCAAGG - Intergenic
932201422 2:69831231-69831253 CTTTAAAAGCAGATTCAAAAAGG + Intronic
932747980 2:74350435-74350457 CTTAAAGCCCAGATCCAACCTGG - Intronic
933547616 2:83735116-83735138 CTTTAACCTGTGATCCAACATGG - Intergenic
940921931 2:159317194-159317216 CTTTAAACACATCCTCAACAAGG - Intergenic
942282709 2:174382750-174382772 TTTTAAACAGAGCTCAAACAGGG - Intronic
943016759 2:182521215-182521237 CTTTAAAAAAATATCAAACAGGG + Intronic
943889324 2:193266147-193266169 ATTTAAACACAAATCCAACCAGG - Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
947121574 2:226820849-226820871 CTATTAACACAGATCAAAAAGGG + Intergenic
1170126398 20:12969190-12969212 CTTTAAGCTCAGTTCCAAAATGG - Intergenic
1170884863 20:20331521-20331543 TTTTAAACACATTTCAAACATGG + Intronic
1173237370 20:41259150-41259172 CTTAAATCACAGTTCCACCATGG + Intronic
1173430119 20:42980307-42980329 GTACAAACATAGATCCAACACGG + Intronic
1173559052 20:43989352-43989374 CTATAAAGACAGAATCAACATGG + Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1180077394 21:45469590-45469612 CTTTGGACACAGACCCCACATGG - Intronic
955048235 3:55381280-55381302 TTTGCAACACAGAACCAACAGGG + Intergenic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
955625249 3:60911524-60911546 CTTTAAACCCAGATCATTCATGG + Intronic
957543141 3:81602303-81602325 CTTTAAAGATAGATTCAACATGG + Intronic
958801950 3:98766376-98766398 ATTTATGCAAAGATCCAACAAGG - Intronic
959132719 3:102377660-102377682 TTCTAAACACAGAGCCAAGAAGG + Intronic
960399573 3:117179951-117179973 CTTTCAAGATAGATCAAACAGGG - Intergenic
962559993 3:136595745-136595767 TTTTAAACACTGATCCATTAGGG - Intronic
967317273 3:188161205-188161227 TTTGAAATACAGATCCAACAAGG - Intronic
967640161 3:191853066-191853088 CTTTAGAGAGAGAACCAACAGGG - Intergenic
968575018 4:1361776-1361798 TTTTAAACACATAGCCATCAAGG + Intronic
969035098 4:4247085-4247107 CTTTAAACACAGCTCAAAAGTGG + Intronic
969829646 4:9784217-9784239 GTTTCAGCACAGACCCAACATGG - Intronic
971062878 4:22992295-22992317 CTTTAAATAAATAGCCAACATGG - Intergenic
976666542 4:87600274-87600296 CTTAAAGCATAAATCCAACAAGG + Intergenic
977842318 4:101723527-101723549 CTTTAATCCCAGATCAAACAAGG + Intronic
981778949 4:148403064-148403086 TTTTAAACACAGATTCTATAAGG + Intronic
982223323 4:153143107-153143129 CTTTATCCACAGATTCCACAAGG + Intergenic
983115082 4:163805447-163805469 CTTTAAACTCAAAACCAAAATGG + Intronic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
985787463 5:1904946-1904968 CATTAAACAGAGATACAAAATGG + Intergenic
988180501 5:27785719-27785741 CTTCAAACACGGAACCAAAAAGG - Intergenic
988797877 5:34668573-34668595 CTTTAAACAAAGACCCAAGAAGG - Intronic
989335523 5:40312141-40312163 CTTCAAACTCAGCTCCAAGATGG - Intergenic
989436604 5:41420737-41420759 CATGAAACACAGATACAAAATGG + Intronic
992301199 5:75382098-75382120 TTTGAAAAACAGATCTAACATGG + Intronic
992504994 5:77378051-77378073 CTCTAGACAAAGAACCAACAGGG - Intronic
996718607 5:126608561-126608583 GATAAATCACAGATCCAACAAGG - Intronic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003736302 6:8881281-8881303 ATTTAATCCCAAATCCAACACGG - Intergenic
1003796183 6:9607687-9607709 CATTTAACACAGCTCCAACTTGG - Intronic
1004765216 6:18718973-18718995 CTTTAAAAACAAATACAACAGGG - Intergenic
1006485973 6:34342252-34342274 CTTTGAACACAGACCTGACAAGG + Intronic
1007057075 6:38896985-38897007 CTGTAATCACAGGACCAACACGG - Intronic
1007635374 6:43296854-43296876 ATTTAAACACAAATCTAAGAGGG - Intronic
1007982048 6:46169994-46170016 CATTAAACACAGTTGCAGCAAGG + Intronic
1010640109 6:78315073-78315095 CTTTATACATAGATTCAAAATGG + Intergenic
1011771335 6:90676694-90676716 CTGTAAGCCCAGCTCCAACAGGG - Intergenic
1013606551 6:111754513-111754535 TTTTAAAGAAAGATCCAACTTGG - Intronic
1016554481 6:145320448-145320470 CTTTAAAAATAAATTCAACATGG - Intergenic
1017050379 6:150387245-150387267 CATTAAACACAGCTGCTACAAGG - Intronic
1024356967 7:48423510-48423532 CTTTAAACAGAGAACCCAAAAGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1033064156 7:138137003-138137025 CAGTAAAAACAGTTCCAACAAGG - Intergenic
1033598367 7:142872026-142872048 CTTGAAGAACAGATCCAAGAAGG + Intronic
1037251283 8:16897498-16897520 CTTTAACCCCAGATGAAACATGG - Intergenic
1039418508 8:37416628-37416650 CTTAAAACACAGACTCATCAGGG + Intergenic
1040698103 8:50027112-50027134 TTTTAAACACAGAAATAACATGG - Intronic
1041054596 8:53971044-53971066 CTAAAAACAAATATCCAACAGGG + Intronic
1046087740 8:109459709-109459731 CTTCAAACAGAGTTCCATCAGGG - Exonic
1046862352 8:119107638-119107660 CCATAAACTCAGATCCTACAGGG + Intergenic
1047944125 8:129858020-129858042 CTTTCAACATAGATCTACCATGG - Intronic
1048331658 8:133474835-133474857 CTTTGAAGACAGATCCAATGAGG - Intronic
1049376398 8:142291457-142291479 CGTTAAACACAGAGCCTCCATGG + Intronic
1050172577 9:2837370-2837392 CTTCAAAGACATTTCCAACAAGG - Exonic
1054771935 9:69091291-69091313 ATATAAACACAGGTCCATCAAGG - Intronic
1055203791 9:73701434-73701456 CTTTTAACACAGTTCCAAAATGG - Intergenic
1186119397 X:6343141-6343163 CTTTATGCAGAGATCAAACATGG + Intergenic
1186529443 X:10280311-10280333 TTCCAAACACAGATCGAACAGGG - Intergenic
1187486044 X:19705186-19705208 CCATAAACACAGATCCCAGACGG - Intronic
1188312780 X:28638126-28638148 TTTTAAACAAATATCCTACAGGG + Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1189886100 X:45546271-45546293 CCTTATACAGAGACCCAACAAGG + Intergenic
1198534416 X:137573244-137573266 CTTTGAACAAAGATCTTACAAGG - Intronic