ID: 1002421097

View in Genome Browser
Species Human (GRCh38)
Location 5:179149466-179149488
Sequence ACCGTGGAAGGCTGCGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002421089_1002421097 14 Left 1002421089 5:179149429-179149451 CCGAAGCTGAGGAAGATGGAGTG 0: 1
1: 0
2: 4
3: 57
4: 823
Right 1002421097 5:179149466-179149488 ACCGTGGAAGGCTGCGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002421097 Original CRISPR ACCGTGGAAGGCTGCGGCCG GGG Intronic
No off target data available for this crispr