ID: 1002421648

View in Genome Browser
Species Human (GRCh38)
Location 5:179152250-179152272
Sequence ATGGTGCTGTCTTCCAGTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002421648_1002421658 16 Left 1002421648 5:179152250-179152272 CCGGAACTGGAAGACAGCACCAT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1002421658 5:179152289-179152311 CCCACCTCAGGGACCTCCCAGGG 0: 1
1: 0
2: 1
3: 42
4: 291
1002421648_1002421651 4 Left 1002421648 5:179152250-179152272 CCGGAACTGGAAGACAGCACCAT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1002421651 5:179152277-179152299 TGCCAGGTCCCTCCCACCTCAGG 0: 1
1: 1
2: 6
3: 55
4: 436
1002421648_1002421652 5 Left 1002421648 5:179152250-179152272 CCGGAACTGGAAGACAGCACCAT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1002421652 5:179152278-179152300 GCCAGGTCCCTCCCACCTCAGGG 0: 1
1: 1
2: 8
3: 72
4: 403
1002421648_1002421656 15 Left 1002421648 5:179152250-179152272 CCGGAACTGGAAGACAGCACCAT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1002421656 5:179152288-179152310 TCCCACCTCAGGGACCTCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002421648 Original CRISPR ATGGTGCTGTCTTCCAGTTC CGG (reversed) Exonic