ID: 1002421650

View in Genome Browser
Species Human (GRCh38)
Location 5:179152269-179152291
Sequence GGGAGGGACCTGGCAAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002421650_1002421656 -4 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421656 5:179152288-179152310 TCCCACCTCAGGGACCTCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 301
1002421650_1002421664 14 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421664 5:179152306-179152328 CCAGGGATGCCACCCACCCCCGG 0: 1
1: 0
2: 8
3: 51
4: 371
1002421650_1002421666 21 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421666 5:179152313-179152335 TGCCACCCACCCCCGGGTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 203
1002421650_1002421665 15 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421665 5:179152307-179152329 CAGGGATGCCACCCACCCCCGGG 0: 1
1: 0
2: 4
3: 46
4: 357
1002421650_1002421658 -3 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421658 5:179152289-179152311 CCCACCTCAGGGACCTCCCAGGG 0: 1
1: 0
2: 1
3: 42
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002421650 Original CRISPR GGGAGGGACCTGGCAAGCTA TGG (reversed) Intronic