ID: 1002421658

View in Genome Browser
Species Human (GRCh38)
Location 5:179152289-179152311
Sequence CCCACCTCAGGGACCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002421650_1002421658 -3 Left 1002421650 5:179152269-179152291 CCATAGCTTGCCAGGTCCCTCCC 0: 1
1: 0
2: 6
3: 15
4: 177
Right 1002421658 5:179152289-179152311 CCCACCTCAGGGACCTCCCAGGG 0: 1
1: 0
2: 1
3: 42
4: 291
1002421648_1002421658 16 Left 1002421648 5:179152250-179152272 CCGGAACTGGAAGACAGCACCAT 0: 1
1: 0
2: 1
3: 27
4: 188
Right 1002421658 5:179152289-179152311 CCCACCTCAGGGACCTCCCAGGG 0: 1
1: 0
2: 1
3: 42
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002421658 Original CRISPR CCCACCTCAGGGACCTCCCA GGG Intronic