ID: 1002422114

View in Genome Browser
Species Human (GRCh38)
Location 5:179154246-179154268
Sequence TCCTATCATCGGGGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002422114_1002422131 16 Left 1002422114 5:179154246-179154268 CCCACCCCACCCCGATGATAGGA 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1002422131 5:179154285-179154307 CCCAACGGGCCTCCTGACCTTGG 0: 1
1: 0
2: 1
3: 17
4: 111
1002422114_1002422125 2 Left 1002422114 5:179154246-179154268 CCCACCCCACCCCGATGATAGGA 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1002422125 5:179154271-179154293 GTGCCCCATCTTTCCCCAACGGG 0: 1
1: 0
2: 2
3: 6
4: 123
1002422114_1002422124 1 Left 1002422114 5:179154246-179154268 CCCACCCCACCCCGATGATAGGA 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1002422124 5:179154270-179154292 GGTGCCCCATCTTTCCCCAACGG 0: 1
1: 0
2: 1
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002422114 Original CRISPR TCCTATCATCGGGGTGGGGT GGG (reversed) Intronic
903645010 1:24890092-24890114 ACATATCTTCGTGGTGGGGTGGG + Intergenic
905584571 1:39106204-39106226 TGGTGTCTTCGGGGTGGGGTGGG + Intronic
907480371 1:54741636-54741658 TCCTGGCATCGTGGTGGGGGAGG + Exonic
907515877 1:54993221-54993243 TCCTTTCATGGAAGTGGGGTGGG - Intergenic
908492698 1:64662282-64662304 TCCTATCATCTGAGTGGTTTGGG + Intronic
916813842 1:168331356-168331378 TCCTATCATGGGTTAGGGGTTGG - Intergenic
918145308 1:181750969-181750991 CCCTGTCAGGGGGGTGGGGTAGG + Intronic
920201885 1:204264702-204264724 TCCTCTCTTGGGGGTTGGGTGGG - Intronic
920306833 1:205023856-205023878 CCCTTTCCTCGGGGTGGTGTGGG + Intergenic
920931435 1:210392788-210392810 TCCTATAAACGAGGTGGGGTGGG - Intronic
921836325 1:219782506-219782528 ACATAGCATGGGGGTGGGGTAGG - Intronic
1062860595 10:806482-806504 TCTTAACCTCGGGGTGGGGGTGG - Intergenic
1066306401 10:34147203-34147225 TGCTGTTATCGGGGTGAGGTGGG - Intronic
1070328529 10:75402766-75402788 TCCTGGGATGGGGGTGGGGTGGG + Intergenic
1072622572 10:97089730-97089752 GCCTGTCATCGTGGAGGGGTGGG + Intronic
1072681253 10:97508585-97508607 TCTTTCCATGGGGGTGGGGTGGG - Intronic
1072769155 10:98123362-98123384 TATGATCTTCGGGGTGGGGTGGG + Intergenic
1072894080 10:99350794-99350816 GCCTATTAGGGGGGTGGGGTTGG - Intronic
1076046149 10:127295668-127295690 TTTTTTTATCGGGGTGGGGTGGG - Intronic
1076566457 10:131402884-131402906 TCTTAACATGGGGATGGGGTGGG + Intergenic
1084174440 11:67416018-67416040 CCCTACCTTCGGGGTGGGGGTGG + Intronic
1084296702 11:68216801-68216823 TCCTAGCTTCCGGGCGGGGTGGG - Intergenic
1096073674 12:48789215-48789237 TCCTAGCAGCGGGGTAGGGGCGG + Intergenic
1097434278 12:59540509-59540531 TCCTAACATCCGGGTGGGGGGGG + Intergenic
1098954187 12:76671469-76671491 TCTTGATATCGGGGTGGGGTCGG + Intergenic
1099181641 12:79476693-79476715 TCCTAATATCGGGGGGGGGGGGG + Intergenic
1106082238 13:26510181-26510203 TACTGTCATCTGCGTGGGGTTGG + Intergenic
1106463250 13:29990893-29990915 TCCAATCCTCGGGGTGGCTTGGG + Intergenic
1107008977 13:35648852-35648874 GCCTGTCATGGGGGTGGGGGTGG + Intronic
1108950047 13:56080614-56080636 TCCTATGGTTGGAGTGGGGTGGG + Intergenic
1112506445 13:99979196-99979218 CCCTGTCCTGGGGGTGGGGTGGG - Intergenic
1126153442 15:45543466-45543488 TAATATCATCTGGGTGGGGTAGG + Intergenic
1129112306 15:73344521-73344543 TCCTAACATGGGGGTGTGGAGGG + Intronic
1129481816 15:75832608-75832630 TTCTATCATGGGGGTGTGTTTGG + Intergenic
1130402659 15:83571995-83572017 TCCTGTCAGCAGGGTGGGGTGGG - Intronic
1130461349 15:84159914-84159936 TCCTAACATTCGGGTGAGGTTGG - Intergenic
1130585019 15:85174081-85174103 TCCTATCATCCATGTGGGGAAGG - Intergenic
1132999186 16:2840664-2840686 TCCCAGCTTCAGGGTGGGGTGGG + Intergenic
1133644941 16:7755159-7755181 TACTATCTTTGGGGTGGGGTTGG + Intergenic
1135346164 16:21690343-21690365 TCCTATTGTGGGGGTGGGGTGGG - Intronic
1141790819 16:86232846-86232868 TTCTATCATCTGGTTGGGGTTGG - Intergenic
1146515876 17:33488973-33488995 TCATCTCATCAGGGAGGGGTTGG - Intronic
1147198384 17:38782759-38782781 CTCTATCAAAGGGGTGGGGTGGG + Intronic
1148644788 17:49213490-49213512 TCCTAGCATCTGGGTGGTGTGGG - Intronic
1149952436 17:61003985-61004007 TCCTCTGTTCAGGGTGGGGTTGG + Intronic
1150485342 17:65539244-65539266 TCCTTTCTTTGGGCTGGGGTGGG + Intronic
1152216979 17:79039035-79039057 TGCTGTCACTGGGGTGGGGTGGG - Intronic
1152424565 17:80211946-80211968 TCATATCATCTGGGTGAGGAAGG - Intronic
1153470964 18:5444843-5444865 TCCTTTTGCCGGGGTGGGGTTGG - Intronic
1153870933 18:9319664-9319686 TCCTTTCATCTGGGTGAGGTTGG + Intergenic
1156098653 18:33566381-33566403 TGCAGTCATTGGGGTGGGGTGGG + Intergenic
1158182121 18:54728301-54728323 CCCTCTCATGGGGGTGGCGTTGG + Intronic
1158755576 18:60320613-60320635 GCCCATCATCGGGGTGGTGGGGG + Intergenic
1159633123 18:70772964-70772986 TCCTATCGTGGGGATGGTGTTGG + Intergenic
1159863798 18:73681479-73681501 TGGTCTCATTGGGGTGGGGTGGG - Intergenic
1164713738 19:30376844-30376866 TCCTAGCCTGGGGGTGGGGTCGG - Intronic
1165247322 19:34505044-34505066 GCCTACCATGGGGGCGGGGTGGG - Exonic
1165851442 19:38852195-38852217 TCCGAGCAGCGGGGTGGGGGCGG - Intronic
930091687 2:47535467-47535489 TCCTCTAATGGGGGTGGGGCTGG + Intronic
931808105 2:65827547-65827569 CCTTATCATGGGGGTGGGGTGGG + Intergenic
934034617 2:88078545-88078567 TCCCCTCATCGGCATGGGGTTGG - Intronic
936655274 2:114478287-114478309 TCTTATCAACAGGGTAGGGTAGG + Intronic
939365472 2:141224808-141224830 GACTGTCATGGGGGTGGGGTGGG + Intronic
945592192 2:211747346-211747368 TCATATCATGGAGGAGGGGTGGG - Intronic
948576629 2:238955902-238955924 TCTGATCAATGGGGTGGGGTGGG + Intergenic
1171430852 20:25082358-25082380 TCCTAGAATGGGGGTGGGGTGGG - Exonic
1172014346 20:31864040-31864062 TCCTGTAATTGGGGTGGGGGCGG - Intronic
1172642319 20:36447887-36447909 GCCTATCAGGGGGGTGGGGGGGG + Intronic
1173825255 20:46043953-46043975 TCCTATTCTGGGGGAGGGGTGGG + Intronic
1176162573 20:63655282-63655304 TCTTCTCATGTGGGTGGGGTAGG + Intergenic
1176943824 21:14954971-14954993 TTCTCTCTTTGGGGTGGGGTGGG + Intergenic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
1179779940 21:43693083-43693105 TCCTAGCAAGTGGGTGGGGTCGG + Intronic
1180854877 22:19039392-19039414 TCCCACCATCGGTGTGAGGTAGG + Intronic
1181137571 22:20779350-20779372 TCATAACATCTGCGTGGGGTGGG + Exonic
1181986040 22:26800488-26800510 TACTAACATGGGGGTGAGGTTGG + Intergenic
1183411899 22:37659621-37659643 ACCCACCATCGGGGTGGGGTTGG + Intronic
1183412015 22:37660372-37660394 ACCCATCATTGGGGTGCGGTTGG - Intronic
1184388564 22:44190023-44190045 TTTTCTCATCTGGGTGGGGTGGG - Intronic
1184557142 22:45239757-45239779 GCCTAGCCTGGGGGTGGGGTGGG + Intronic
950131730 3:10551986-10552008 GCCTATCATGGGGCTGGGTTTGG + Intronic
950575277 3:13828514-13828536 TCCTTTCATCTGGGTGGTGGAGG + Intronic
951375482 3:21910145-21910167 TCCTATCATGGAGGTGAAGTAGG - Intronic
953838286 3:46366690-46366712 ACCTATCATCGTGGGTGGGTTGG - Intergenic
955347600 3:58172638-58172660 TCCTTTTGTGGGGGTGGGGTGGG + Intergenic
961622521 3:128235884-128235906 GCCTGTCACTGGGGTGGGGTTGG - Intronic
965304874 3:167051788-167051810 TCCTGGGATGGGGGTGGGGTAGG - Intergenic
966150941 3:176867253-176867275 TCCTGTCATGGGGTGGGGGTAGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
970617090 4:17778284-17778306 TACTATCATCAGTGTGGTGTGGG + Intronic
972398559 4:38678705-38678727 TGCTATCATGGAGGTGGGGATGG + Intronic
972892267 4:43573406-43573428 TCATATCAGCTGGATGGGGTGGG + Intergenic
977572740 4:98646453-98646475 GCCTAACACCTGGGTGGGGTGGG - Intronic
979800214 4:124898853-124898875 GCCTATCATGGGGTGGGGGTAGG + Intergenic
985804436 5:2031869-2031891 TCCTCTCATGGGGCTGGGGTTGG + Intergenic
989572106 5:42954344-42954366 TGGTATCATCAGGGTGAGGTTGG + Intergenic
995363194 5:111322637-111322659 ACCTAGAATCAGGGTGGGGTGGG + Intronic
1002422114 5:179154246-179154268 TCCTATCATCGGGGTGGGGTGGG - Intronic
1006458054 6:34143301-34143323 TCCTGTCCTTGGGGTGCGGTGGG - Intronic
1006808465 6:36804661-36804683 GCCTATGCTGGGGGTGGGGTGGG - Intronic
1007088873 6:39169561-39169583 TCCCATCAACAGGGTGGGGGTGG + Intergenic
1007169519 6:39852807-39852829 TCCTAGTAGCAGGGTGGGGTAGG - Intronic
1008794922 6:55291494-55291516 GCCTATCATGGGGTGGGGGTAGG + Intergenic
1011557482 6:88586010-88586032 TGATTTCACCGGGGTGGGGTGGG - Intergenic
1012246313 6:96930069-96930091 TTGTATCATCTGGGTGGGGAAGG - Intronic
1015344121 6:132135594-132135616 TCATTTCATATGGGTGGGGTGGG - Intergenic
1019180966 6:170187126-170187148 TCCTGTCATCGGGGCTGGGCTGG - Intergenic
1023968880 7:44977549-44977571 CCCTGTCATCTGGGTGGGGCTGG - Intronic
1027414073 7:77955940-77955962 TTATATAATGGGGGTGGGGTGGG - Exonic
1029354426 7:100040896-100040918 ATCTATGATGGGGGTGGGGTGGG + Exonic
1030488172 7:110198079-110198101 TTCTGTCATTGGGTTGGGGTCGG - Intergenic
1032890950 7:136193793-136193815 TCCTTACCTAGGGGTGGGGTGGG + Intergenic
1033906004 7:146203655-146203677 TCCTCTCCTGGGGGTGGGTTGGG + Intronic
1036407011 8:8464030-8464052 CCTTATCATCGGGGTAGTGTAGG + Intergenic
1038219970 8:25598084-25598106 TCCTAACATCTGTGTGGGGAAGG - Intergenic
1039077308 8:33703447-33703469 TACTATCATAGGGAAGGGGTTGG - Intergenic
1044593356 8:93935313-93935335 GCCTATAAATGGGGTGGGGTAGG + Intergenic
1044593366 8:93935347-93935369 GCCTATAAATGGGGTGGGGTAGG + Intergenic
1049272191 8:141701643-141701665 TCCCATCAGCCTGGTGGGGTGGG - Intergenic
1049621824 8:143601718-143601740 TCCTCTCATCGGGGTGGCTGTGG + Exonic
1053341690 9:37341524-37341546 TCCTAGCCTGGGGATGGGGTTGG + Intronic
1053380073 9:37641680-37641702 TCCTATCTTCGGTGTAGGATAGG - Intronic
1057189053 9:93076026-93076048 TCCTGTCATGGGGATGGTGTGGG + Intronic
1058746704 9:107998739-107998761 TCATAGCATGGAGGTGGGGTTGG - Intergenic
1058996252 9:110301518-110301540 TCCTATTATAAGGGTGGGGGTGG - Intergenic
1059929091 9:119243209-119243231 TCCTGTCAGAGGGGTAGGGTGGG - Intronic
1061065602 9:128275834-128275856 TCCTGCCATCGGAGTGGGGCTGG + Intronic
1186874653 X:13804853-13804875 TCATACCATCTGGTTGGGGTTGG + Intronic
1187470433 X:19564910-19564932 TCACATCATAGGGGTGGGGGTGG - Intronic
1187701293 X:21966549-21966571 TGCGACCATGGGGGTGGGGTGGG + Intronic
1189637867 X:43031418-43031440 GCCTGTCATGGGGTTGGGGTGGG + Intergenic
1190212320 X:48458712-48458734 TCCTCCCATGGGGTTGGGGTTGG + Exonic
1192169781 X:68847072-68847094 CCCCATGATGGGGGTGGGGTGGG - Intergenic
1195395305 X:104404271-104404293 GCCTATCATGGGGTCGGGGTGGG - Intergenic
1196821456 X:119704496-119704518 GCCTATAATGGTGGTGGGGTGGG + Intergenic
1198806956 X:140502879-140502901 TCCCATCCTAGGGGCGGGGTGGG - Intergenic
1199018256 X:142845806-142845828 ACTTATCATCTGGTTGGGGTGGG - Intergenic
1202377906 Y:24255220-24255242 TCCTAACATTCGGGTGAGGTTGG + Intergenic
1202492876 Y:25414901-25414923 TCCTAACATTCGGGTGAGGTTGG - Intergenic