ID: 1002424508

View in Genome Browser
Species Human (GRCh38)
Location 5:179167296-179167318
Sequence GCGAGAACAGCGGCCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002424501_1002424508 6 Left 1002424501 5:179167267-179167289 CCGAGCGGCCACCAGGTGGCGCT 0: 1
1: 1
2: 1
3: 29
4: 169
Right 1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG No data
1002424500_1002424508 7 Left 1002424500 5:179167266-179167288 CCCGAGCGGCCACCAGGTGGCGC 0: 1
1: 1
2: 6
3: 24
4: 207
Right 1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG No data
1002424498_1002424508 12 Left 1002424498 5:179167261-179167283 CCGGGCCCGAGCGGCCACCAGGT 0: 1
1: 0
2: 1
3: 15
4: 129
Right 1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG No data
1002424503_1002424508 -5 Left 1002424503 5:179167278-179167300 CCAGGTGGCGCTGCTGCCGCGAG 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG No data
1002424502_1002424508 -2 Left 1002424502 5:179167275-179167297 CCACCAGGTGGCGCTGCTGCCGC 0: 1
1: 0
2: 6
3: 68
4: 383
Right 1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002424508 Original CRISPR GCGAGAACAGCGGCCCGGGC CGG Intronic
No off target data available for this crispr