ID: 1002424940

View in Genome Browser
Species Human (GRCh38)
Location 5:179169444-179169466
Sequence GAACTAGGAGGCACTAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002424940_1002424954 14 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424954 5:179169481-179169503 GGTCTGGGTGAGGAGGTGGATGG 0: 1
1: 0
2: 9
3: 115
4: 965
1002424940_1002424956 26 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424956 5:179169493-179169515 GAGGTGGATGGAGGATGATGTGG No data
1002424940_1002424958 30 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424958 5:179169497-179169519 TGGATGGAGGATGATGTGGGTGG 0: 1
1: 0
2: 2
3: 79
4: 675
1002424940_1002424953 10 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424953 5:179169477-179169499 GGTAGGTCTGGGTGAGGAGGTGG 0: 1
1: 0
2: 3
3: 60
4: 607
1002424940_1002424947 -2 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424947 5:179169465-179169487 TCTCTGGACCCAGGTAGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 206
1002424940_1002424946 -7 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424946 5:179169460-179169482 CTAGTTCTCTGGACCCAGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 128
1002424940_1002424949 4 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424949 5:179169471-179169493 GACCCAGGTAGGTCTGGGTGAGG No data
1002424940_1002424948 -1 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424948 5:179169466-179169488 CTCTGGACCCAGGTAGGTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 302
1002424940_1002424955 17 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG No data
1002424940_1002424952 7 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424952 5:179169474-179169496 CCAGGTAGGTCTGGGTGAGGAGG 0: 1
1: 0
2: 2
3: 52
4: 452
1002424940_1002424957 27 Left 1002424940 5:179169444-179169466 CCAGCCTTAGTGCCTCCTAGTTC 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1002424957 5:179169494-179169516 AGGTGGATGGAGGATGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002424940 Original CRISPR GAACTAGGAGGCACTAAGGC TGG (reversed) Intronic
900309222 1:2025295-2025317 GAACTAAGAAGGACTGAGGCCGG - Intronic
900779372 1:4607742-4607764 GGACTAGGAGCCACCAGGGCTGG - Intergenic
901158045 1:7153911-7153933 GAACCAGGAGCCACTAGGCCTGG + Intronic
901159306 1:7163011-7163033 GACCTGTGAGGCACTAAGGGAGG + Intronic
901241792 1:7698551-7698573 GAAGAAGGAGGCACTGAGGTGGG - Intronic
903499454 1:23793398-23793420 GGTCTAGGAGGCCCTAGGGCTGG - Intronic
905783131 1:40730285-40730307 GAACTTTGAGGCACCAAGGAGGG - Intronic
906640883 1:47439598-47439620 GAAGTGGCAGCCACTAAGGCCGG - Exonic
906693226 1:47806701-47806723 GAACTAGGAAGGAGTGAGGCAGG + Intronic
907112775 1:51941412-51941434 GAGATAGGAGGCAGGAAGGCTGG + Intronic
907284325 1:53370449-53370471 GAAATAGCAGGCCCTCAGGCAGG + Intergenic
911996135 1:104769222-104769244 GAACTTTGAGGGGCTAAGGCAGG + Intergenic
913539622 1:119806186-119806208 GAACTTTGAGACACCAAGGCGGG - Intronic
914718059 1:150267853-150267875 GGAAGAGGAGGCACTAAGGGAGG - Intronic
918082610 1:181218997-181219019 GCTCTAGGAGGCACTGTGGCCGG + Intergenic
919715224 1:200769172-200769194 GCACTAGGAGGAACAAAGGATGG - Intronic
922074993 1:222234915-222234937 GAACTAGCAGGTACAAAAGCAGG - Intergenic
923198257 1:231688355-231688377 GAACTCAGAAGCACTAAGGAAGG - Intronic
924905489 1:248447542-248447564 GAATTAGCAGGCACTAGGGGTGG - Intergenic
924922402 1:248644492-248644514 GAATTAGCAGGCACTAGGGGTGG + Intergenic
1063570702 10:7212094-7212116 GGACTTGGAGGCACTAGGTCTGG + Intronic
1064018044 10:11787898-11787920 GCACTGGGAGGCAGCAAGGCTGG + Intergenic
1067087673 10:43251411-43251433 CCCCTAGGAGGCACAAAGGCTGG + Intronic
1067410989 10:46064401-46064423 AAAGGAGGAGGGACTAAGGCAGG + Intergenic
1073995448 10:109310757-109310779 GATATAAGAAGCACTAAGGCTGG + Intergenic
1074753548 10:116608888-116608910 GCACGAGGGGGCACTAGGGCTGG - Intronic
1076187962 10:128463715-128463737 GGACCAGGAGGCACAAAGCCAGG + Intergenic
1076935299 10:133564932-133564954 GAGGTAGGAGCCACTATGGCAGG + Intronic
1077464662 11:2728023-2728045 GAACAGGGAGGCAATGAGGCTGG - Intronic
1077698786 11:4420337-4420359 GAATTTGGAGGCAAGAAGGCAGG + Intergenic
1080473018 11:32564469-32564491 GAACTAGGAGAGACTAGGCCGGG - Intergenic
1081300543 11:41445512-41445534 GAAGAAGAAGGCACTGAGGCTGG + Intronic
1083080396 11:60086562-60086584 TAAGAAGGAGGCAATAAGGCTGG + Intergenic
1085799056 11:79571007-79571029 GGACTGGGAGGCAGTAAGCCTGG - Intergenic
1091344396 11:134843279-134843301 GAACTGGGAGGGAGAAAGGCTGG - Intergenic
1095642660 12:44502588-44502610 GAGCTAGGAGCCACAAAGTCTGG - Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1104466410 12:128994259-128994281 GAGCTAGGAAGCACTGAGACAGG + Intergenic
1105206034 13:18225089-18225111 GAACAAGGAGGCACTGATGGTGG - Intergenic
1108988766 13:56629086-56629108 GAACTGGGAGGCAGCAAGCCTGG + Intergenic
1115814345 14:37146957-37146979 GAATTAGGAGGCATTAAGGTTGG - Intronic
1118093045 14:62503938-62503960 GAACTAGGAGACACCTAAGCAGG - Intergenic
1120733233 14:88025664-88025686 GACCTAGTAGTCAGTAAGGCAGG - Intergenic
1122423094 14:101589701-101589723 GTTGGAGGAGGCACTAAGGCTGG + Intergenic
1124038827 15:26081800-26081822 GAAGCAGGAGTCACTAGGGCTGG - Intergenic
1124223633 15:27870571-27870593 GCACTAGGAGACACACAGGCTGG + Intronic
1128581210 15:68811412-68811434 GAACTGGGAGGGATTAAGGCAGG + Intronic
1133728597 16:8559337-8559359 GAACTGGGTGGAATTAAGGCAGG - Intergenic
1137024570 16:35459738-35459760 GGACTTGGAGGCACGAAGGACGG + Intergenic
1138636977 16:58347774-58347796 GAACAAGGAGGCAGGAGGGCTGG + Intronic
1139657911 16:68400136-68400158 GGACTAGGAGGCTCTGTGGCAGG - Intronic
1144040056 17:11402795-11402817 AAACTGTGAGGCACTGAGGCAGG + Intronic
1147381849 17:40061002-40061024 GAACTAGGAGGCAGTGGGGAGGG - Intronic
1149606816 17:57930944-57930966 GAACTAGGAGAGACTGAGGTTGG - Intronic
1151393110 17:73801246-73801268 GAAGTGGGTGGCAGTAAGGCAGG - Intergenic
1152895858 17:82910941-82910963 GGACTAGGAGGCAGAAAGGGAGG - Intronic
1154356033 18:13623838-13623860 GAATTAGGAGGCAGGAAGCCTGG - Intronic
1155536949 18:26828478-26828500 TGACCAGGAGGCAGTAAGGCAGG - Intergenic
1155774176 18:29737865-29737887 GTCCCTGGAGGCACTAAGGCTGG + Intergenic
1161325372 19:3661141-3661163 GCACTAGGAGGGACCATGGCGGG - Intronic
1166672767 19:44721475-44721497 GAAGTAGGAGCCACAGAGGCTGG + Intergenic
1168613732 19:57821210-57821232 GAGCCAGGTGGCACTCAGGCTGG - Intronic
925205228 2:2000312-2000334 GAACTAGGAGCCACAAAAGGGGG - Intronic
927922155 2:26981325-26981347 GAAGTAGCTGGCCCTAAGGCCGG + Intronic
932346837 2:71001214-71001236 GAAGTAGGAGGCGGTACGGCCGG + Intergenic
934163394 2:89272962-89272984 GGACAGGGAGGCCCTAAGGCGGG - Intergenic
934203880 2:89909562-89909584 GGACAGGGAGGCCCTAAGGCGGG + Intergenic
935575850 2:104709642-104709664 GACCTAGGAGGCTCTTAGGTTGG - Intergenic
937144836 2:119635713-119635735 GAATTAGGAGACCCTAAGGAAGG + Intronic
940312339 2:152291906-152291928 GAACCAGGTGGCACAAAGGGAGG + Intergenic
945622470 2:212157842-212157864 GGACTAGTAGGCACTTAGACTGG + Intronic
948906588 2:240982529-240982551 GCAGTAGGAGCCACCAAGGCTGG + Intronic
1172979644 20:38931276-38931298 AGAGTAGGAGGCATTAAGGCTGG + Intronic
1175013343 20:55762597-55762619 GAGATTGGAGGCAGTAAGGCAGG + Intergenic
1177866748 21:26521242-26521264 GAATTAAGAGGCACTAATCCAGG + Intronic
1179789433 21:43747943-43747965 GGCTTAGGAGGCACTAAGGATGG - Intronic
1180759931 22:18193627-18193649 GAACAAGGAGGCACTGATGGTGG + Intergenic
1180770243 22:18377926-18377948 GAACAAGGAGGCACTGATGGTGG + Intergenic
1180775737 22:18431073-18431095 GAACAAGGAGGCACTGATGGTGG - Intergenic
1180776087 22:18484740-18484762 GAACAAGGAGGCACTGATGGTGG - Intergenic
1180808810 22:18742110-18742132 GAACAAGGAGGCACTGATGGTGG - Intergenic
1180828184 22:18880882-18880904 GAACAAGGAGGCACTGATGGTGG + Intergenic
1181071739 22:20347084-20347106 GAACAAGGAGGCACTGATGGTGG - Intergenic
1181194808 22:21176026-21176048 GAACAAGGAGGCACTGATGGTGG - Intergenic
1181214637 22:21316744-21316766 GAACAAGGAGGCACTGATGGTGG + Intergenic
1181525039 22:23477986-23478008 GAACAAGGAGGCACTGATGGTGG + Intergenic
1182063009 22:27411152-27411174 GGACTAGGAGGCACTGGGGGAGG - Intergenic
1183648151 22:39138605-39138627 GAGAAAGGAGGCACAAAGGCAGG + Intronic
1184236493 22:43186048-43186070 GAACTAGGAGTCCCTGAGCCTGG - Intronic
1203232075 22_KI270731v1_random:119110-119132 GAACAAGGAGGCACTGATGGTGG + Intergenic
1203278280 22_KI270734v1_random:106884-106906 GAACAAGGAGGCACTGATGGTGG + Intergenic
949337421 3:2991225-2991247 GAACGAGGAGGGACTGAGGTAGG + Intronic
951014516 3:17715558-17715580 GCACTTTGAGGGACTAAGGCAGG + Intronic
954630087 3:52043386-52043408 GAAATAGCATGCACAAAGGCTGG + Intergenic
956908449 3:73791444-73791466 GAACTAGGAGCATCAAAGGCAGG - Intergenic
958463814 3:94433090-94433112 GAACAGGGAGGCAGTAGGGCAGG - Intergenic
964651342 3:159015014-159015036 CAAGAAGAAGGCACTAAGGCGGG - Intronic
965017949 3:163184336-163184358 GAAGTAAGAGGAACTAATGCTGG - Intergenic
966113382 3:176431189-176431211 GAACTTGGAGTCTCTAAGACAGG - Intergenic
967027375 3:185576710-185576732 CTACTAGGGGGCACTGAGGCAGG + Intergenic
967459842 3:189732945-189732967 GAACTAGGAAGTACTAAGTAAGG + Intronic
975962382 4:79928217-79928239 GAACCATAAGGCACTATGGCAGG + Intronic
978410151 4:108417020-108417042 GGGCCAGGAGGCACTAATGCTGG + Intergenic
982563297 4:156957782-156957804 GAAATGGGAGGCACAAAGGGAGG - Intronic
984531348 4:180920356-180920378 GAACTTGTAGGCATTAAGGAAGG - Intergenic
989027815 5:37087335-37087357 GGAAAAGGAGGCAGTAAGGCAGG - Intergenic
990569247 5:57061163-57061185 AAACTAGGAAGCAGTAAGGAAGG - Intergenic
992743531 5:79797106-79797128 GAATAAGGAGGCATTAAGGTTGG - Intronic
1001315121 5:170636444-170636466 GAACCAGGAGGCACTATCCCAGG + Intronic
1001409096 5:171497597-171497619 GAAGAAGGCGGCACTTAGGCTGG - Intergenic
1002424940 5:179169444-179169466 GAACTAGGAGGCACTAAGGCTGG - Intronic
1002542390 5:179914781-179914803 GCACTTTGAGACACTAAGGCGGG + Intronic
1005925908 6:30445451-30445473 GAACTAGAAGCCACCAAGACCGG + Intergenic
1006383085 6:33712129-33712151 GAACTAGGAAGCACTAAAGAAGG - Intergenic
1009835185 6:68991391-68991413 GAAATAGAAGGCACAATGGCAGG + Intronic
1012396274 6:98801079-98801101 GGACTAGGAGACAGGAAGGCAGG + Intergenic
1015851130 6:137573905-137573927 GAATCAGGAGGCACAGAGGCAGG + Intergenic
1018059561 6:160079637-160079659 GAACAAGGAGGCTGTAAGGACGG + Exonic
1018849194 6:167575607-167575629 CAACTAGGATGCACTGAGACGGG + Intergenic
1019761869 7:2818893-2818915 TAACTAGAAGGCTGTAAGGCAGG + Intronic
1023649841 7:42357835-42357857 GAACTAGGAGGCAAAAAGAAGGG + Intergenic
1035284052 7:157795136-157795158 CATCTAGGAGGCACTTCGGCGGG + Intronic
1035341280 7:158164152-158164174 GAACGAGAAGGCGCCAAGGCAGG + Intronic
1038801166 8:30750359-30750381 CTACTTGGGGGCACTAAGGCAGG + Intronic
1039888306 8:41668082-41668104 GATCCAGGAGGCAGAAAGGCAGG + Intronic
1041390527 8:57343618-57343640 GAGCTAGGAGCCTCTGAGGCTGG - Intergenic
1042427459 8:68664702-68664724 GAACTAGGGCACACTAAGGAAGG - Intronic
1042573233 8:70190364-70190386 AAACTATGAGTCACTAAGTCAGG + Intronic
1046663634 8:116975997-116976019 GAACTAGAAGCCAATAAGGAAGG + Intronic
1049443567 8:142619898-142619920 GGACTGGGAGGCGCTGAGGCAGG - Intergenic
1049625091 8:143616290-143616312 GAACTGGGTGGGACTATGGCAGG + Intronic
1050818434 9:9845977-9845999 CAACTGGGAGGAACTAAGGCGGG + Intronic
1053371776 9:37567670-37567692 GAACTAGGAGGCACCATGCCTGG + Intronic
1057685551 9:97230942-97230964 GCAGTAGGATCCACTAAGGCTGG + Intergenic
1057846428 9:98529877-98529899 GAGCTAGGAGGCAAGAAGGATGG - Intronic
1059284773 9:113162926-113162948 GAACGTGCAGGCACTGAGGCTGG + Exonic
1061265613 9:129503198-129503220 AAACTTGGAGGCAGGAAGGCTGG + Intergenic
1061450112 9:130663213-130663235 GAACTAGGAGGCAAGAAGGAAGG + Intergenic
1203384585 Un_KI270438v1:12085-12107 GTACAAGGTGGCAGTAAGGCTGG + Intergenic
1185927684 X:4165427-4165449 GAACTTTGAGACACTAAGGTAGG - Intergenic
1190025515 X:46918695-46918717 GGTCTAGGAGGCCCTAAGCCGGG + Intronic
1191942897 X:66499444-66499466 GAACCAGGAGGGACAGAGGCTGG - Intergenic
1194448354 X:94013416-94013438 GAATTTGGAAGCTCTAAGGCAGG + Intergenic
1196020868 X:110989746-110989768 CAACTAGGAGGCAGGAAAGCTGG - Intronic
1201749098 Y:17413132-17413154 GCACTAGGTGGCACTTGGGCTGG - Intergenic