ID: 1002428832

View in Genome Browser
Species Human (GRCh38)
Location 5:179191529-179191551
Sequence CAGTGTGACCTAAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002428825_1002428832 11 Left 1002428825 5:179191495-179191517 CCCCACACATCATATTCTGCCGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG 0: 1
1: 1
2: 2
3: 20
4: 228
1002428827_1002428832 9 Left 1002428827 5:179191497-179191519 CCACACATCATATTCTGCCGCTG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG 0: 1
1: 1
2: 2
3: 20
4: 228
1002428826_1002428832 10 Left 1002428826 5:179191496-179191518 CCCACACATCATATTCTGCCGCT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG 0: 1
1: 1
2: 2
3: 20
4: 228
1002428828_1002428832 -8 Left 1002428828 5:179191514-179191536 CCGCTGCTCTGTCACCAGTGTGA 0: 1
1: 0
2: 0
3: 20
4: 296
Right 1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG 0: 1
1: 1
2: 2
3: 20
4: 228
1002428824_1002428832 12 Left 1002428824 5:179191494-179191516 CCCCCACACATCATATTCTGCCG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG 0: 1
1: 1
2: 2
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002428832 Original CRISPR CAGTGTGACCTAAGGAAAGA GGG Intronic
900139068 1:1131859-1131881 CAGTGTGACGGAAGGAAATGCGG - Intergenic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
903420676 1:23216553-23216575 TAGTGTGACCTTGGGCAAGACGG + Intergenic
903789854 1:25885374-25885396 AAGTGGGACCTTAGGAAGGAAGG - Intronic
906492271 1:46278058-46278080 CAGTGCAACCTAGGGACAGAAGG - Exonic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
908037282 1:60069612-60069634 CAGGTTAACTTAAGGAAAGAGGG + Intronic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
910335490 1:86124984-86125006 CACCTTGATCTAAGGAAAGAAGG - Exonic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
916948170 1:169750778-169750800 CAGTGTGTTCTAAGACAAGAAGG - Intronic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
920398428 1:205662582-205662604 CAGTTTGACAGAAGGAAAGGCGG - Intronic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921648091 1:217643450-217643472 CAGTGTGTCCCATGGACAGAAGG - Intronic
923682946 1:236133701-236133723 GAGTGTGACTTAAGGAAGCATGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
1063744305 10:8862395-8862417 CAGTGTGACAAAGGGAAACAGGG + Intergenic
1065239561 10:23692590-23692612 CAGTGGGAAATAAGGAAGGAGGG + Intergenic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066371828 10:34824154-34824176 TAGTGTGTCCAAAGCAAAGAGGG - Intergenic
1069818975 10:71216121-71216143 CAGTGTGACCTTGGGCAAGTTGG - Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073722286 10:106186452-106186474 TGGTGTGACCTAAGAAAAGCTGG + Intergenic
1074665024 10:115712375-115712397 CAGTGGTATCTAAGGAAAGAAGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1079056385 11:17209500-17209522 GAGTGTGCCTTCAGGAAAGAAGG + Intronic
1080084518 11:28262491-28262513 CACTGTGAAGTAATGAAAGATGG + Intronic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1082097091 11:48139715-48139737 CACTGTGTCCTGTGGAAAGATGG + Exonic
1084935748 11:72585684-72585706 CAGTGAGCCCTAGGGAAGGAAGG - Intronic
1085738634 11:79060984-79061006 CAGTGGGAACTAGAGAAAGATGG + Intronic
1086071490 11:82804469-82804491 CAGTTTGAATTAAGGAAAGTGGG + Intergenic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1090745732 11:129703457-129703479 CAGAGTGTCCCATGGAAAGAAGG - Intergenic
1094623826 12:32104777-32104799 GAGTGCGAGATAAGGAAAGATGG + Intergenic
1098599545 12:72314566-72314588 CAGTGTCACTGAAGGAAAAATGG + Intronic
1100513126 12:95297153-95297175 AAGTTTGACTTAAGAAAAGAAGG - Intronic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107269910 13:38603050-38603072 CAGAGTGAAATAAGGAAAGCAGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108584891 13:51862649-51862671 CAGTCTGAGCTTAGGAGAGATGG + Intronic
1108834409 13:54523336-54523358 CAGTGTGACATAACTAGAGATGG - Intergenic
1113596837 13:111539650-111539672 CAGTCTGACCAACTGAAAGAAGG - Intergenic
1114189143 14:20428029-20428051 CAGTTTGCCCAAAAGAAAGAAGG + Intergenic
1114769892 14:25417078-25417100 CAGTGCCACCTGAGGAAGGAAGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1119286536 14:73459114-73459136 CATTGAGACCAAAGAAAAGAAGG - Intronic
1120133076 14:80829943-80829965 CAATGTGAAGGAAGGAAAGAAGG + Intronic
1121632242 14:95429957-95429979 CAGTCAGAACTAAGGAAGGAAGG + Intronic
1122573991 14:102729813-102729835 TTATGTGAGCTAAGGAAAGATGG + Exonic
1124149042 15:27160269-27160291 CAGACTGACCTAAGGAAAGATGG - Intronic
1125724118 15:41859570-41859592 CAGTGTGACCTTATGAGAGGAGG + Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1126678112 15:51179177-51179199 CAGTGTGACCTAGTGAAGAAAGG - Intergenic
1127799993 15:62469885-62469907 CATTTTGAGCTCAGGAAAGATGG - Intronic
1128565661 15:68699209-68699231 CAGTTGGACCCAAGGAGAGAAGG + Intronic
1129040982 15:72686090-72686112 CCGAGTGACCTAAGGAATCAGGG - Exonic
1129968006 15:79753998-79754020 CAGTCTGTCTTAAGGAAAGAGGG - Intergenic
1130246436 15:82254270-82254292 CAGTGGGATCTAAGGAGAGATGG - Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1132155088 15:99490156-99490178 CAGTGGGACATAACAAAAGATGG - Intergenic
1136538794 16:30916552-30916574 TAGTGTGACCAAAACAAAGATGG - Intergenic
1136866775 16:33765633-33765655 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1137822121 16:51456185-51456207 CAGTATGACCTAAGAATTGAAGG + Intergenic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1139063354 16:63282694-63282716 CTGAGTGACCTAATGAATGAAGG - Intergenic
1140017414 16:71200942-71200964 CAGTTTGATCAAAGGAAACAGGG - Intronic
1140955180 16:79856855-79856877 TAGTGTGACCCATGGACAGAAGG - Intergenic
1203105387 16_KI270728v1_random:1350569-1350591 CACTGTACCCCAAGGAAAGAAGG - Intergenic
1203128127 16_KI270728v1_random:1611799-1611821 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1143054909 17:4155574-4155596 CAGTGTCATCTCAAGAAAGAGGG + Intronic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1151431352 17:74065614-74065636 CAGTGTGTCCCAAGGAACAAGGG + Intergenic
1152325379 17:79633029-79633051 CAGAGTGACTTTAGGAAAAATGG - Intergenic
1152341340 17:79727320-79727342 CACTGTACCCCAAGGAAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157258252 18:46157260-46157282 GAGAGTGACCCAAGGAAGGAGGG + Intergenic
1157294008 18:46428994-46429016 CAGTGTGACAGAGGGAAGGAGGG - Intronic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159614004 18:70558977-70558999 CAGTGTGTCCTAATGAACAAAGG + Intergenic
1160993034 19:1868422-1868444 CAGTGTGACCTCAGGAAGACAGG + Intergenic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1163765774 19:19162573-19162595 CAGAGGGACCTATGGAAAAAAGG - Intronic
1164483166 19:28632213-28632235 CAATGGGACCCAAGGAAAGCAGG + Intergenic
1165164259 19:33840402-33840424 CAATGTGCCCTACAGAAAGATGG - Intergenic
1165164525 19:33842207-33842229 CAGTGTGCCCTATATAAAGATGG - Intergenic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1166338040 19:42121053-42121075 CAGTGGGACCAAGGGAATGAAGG - Intronic
1166426704 19:42685397-42685419 AAGAGTGACCCAAGGAAAGTGGG + Intronic
1168133687 19:54337078-54337100 CACGGTGACCTCAGGAGAGAAGG - Exonic
925223855 2:2164907-2164929 CACTGTGACAGAAGGAAAGAAGG + Intronic
925290155 2:2742540-2742562 CACTGAGACCTAAGGAAAAATGG + Intergenic
925458651 2:4041643-4041665 AAGTGAGACAGAAGGAAAGAAGG - Intergenic
927437057 2:23075774-23075796 CAGTGAGACATGAAGAAAGAGGG - Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928578314 2:32679014-32679036 CACTGCCACCTAAGGAAATAAGG + Intronic
928922183 2:36537625-36537647 CCGTGTGAACGAATGAAAGAAGG - Intronic
930608260 2:53514547-53514569 TAGTGTGGACTAAAGAAAGATGG - Intergenic
931222673 2:60302167-60302189 CTGTGTGACCCATGGAGAGAGGG - Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
935687112 2:105694081-105694103 CAGAGTGGCCTTTGGAAAGATGG - Intergenic
936416049 2:112313024-112313046 AGGTGTGACCTAAAAAAAGAAGG + Intronic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
937380323 2:121370772-121370794 CAGTGTCACCTAGGGACAGGTGG - Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
940781279 2:157936775-157936797 TGGCATGACCTAAGGAAAGAAGG - Intronic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
944376991 2:199057098-199057120 GAATGTGACCAAAGGAAATAAGG + Intergenic
945627682 2:212231421-212231443 CAGTCTGAAGTAATGAAAGATGG - Intronic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
948126089 2:235565487-235565509 CAGTGTGACCTACGAAAGGTGGG + Intronic
948154657 2:235771449-235771471 CAGGGTGACCTAAGGCATGTGGG + Intronic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
1168889703 20:1286993-1287015 AAGTGGGTCCCAAGGAAAGATGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169268090 20:4179866-4179888 CAATGTGACCCAAGGAAAATCGG - Intronic
1170176102 20:13471746-13471768 CAGCGTGATCTATGCAAAGACGG + Intronic
1170556434 20:17518717-17518739 CAGCCAGACCTCAGGAAAGACGG + Intronic
1170657904 20:18306726-18306748 AACTGTGACCTACAGAAAGAAGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171105916 20:22432269-22432291 CAGTGTAATTTATGGAAAGATGG + Intergenic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1174375350 20:50123196-50123218 TAGAGTGAGCTAAGGAAAAATGG - Intronic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1175626185 20:60489875-60489897 CAGTGTGCCCTTTGAAAAGATGG + Intergenic
1176374308 21:6079633-6079655 CAGTGTGGCCTAAGCAAGGGAGG + Intergenic
1179749168 21:43458612-43458634 CAGTGTGGCCTAAGCAAGGGAGG - Intergenic
1181261235 22:21599360-21599382 CAGTGTGCCCTCAGAAAACAGGG - Intronic
1181479077 22:23186190-23186212 CCGTTTGCCCTAAGGAAAAATGG + Intronic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1181908309 22:26217360-26217382 CAGTGTGGCCGAAAGAAAAAAGG - Intronic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
1183364868 22:37401564-37401586 CAGTGGGCCCTCAGGAAACACGG + Intronic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
954115143 3:48462962-48462984 CAGTGTGTCCTTAGGAAGCAAGG - Intronic
954174625 3:48834265-48834287 CAGTGTGAACCAAGCAAAGGAGG + Intronic
955139062 3:56250870-56250892 CAGTGAGACCCAGTGAAAGATGG + Intronic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
957193667 3:77040463-77040485 CAGTGGAGCCTAAGGAGAGAGGG + Intronic
957910943 3:86619530-86619552 CAGTGTGACCTAGGGTGAAAGGG - Intergenic
959327507 3:104956276-104956298 CTAAGTAACCTAAGGAAAGAAGG + Intergenic
959600029 3:108171363-108171385 CAGTTTGACGTAAAGAAAGGGGG + Intronic
961041054 3:123678575-123678597 CAGGCTCACCTCAGGAAAGATGG + Intronic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
961777372 3:129298201-129298223 CTCTGTCACCAAAGGAAAGAAGG - Intronic
961978665 3:131054007-131054029 CAGTGTGTCTTAGGGACAGAGGG + Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
963114361 3:141713737-141713759 CAATGTGACCTGAGGAAGAAGGG + Intergenic
966992235 3:185244568-185244590 GAGTGTGACATTTGGAAAGAAGG + Intronic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971784598 4:31084626-31084648 CAGTGTCACATAAGGAAAGCAGG + Intronic
972396250 4:38662221-38662243 AAGTGTGACCCAAGATAAGAAGG - Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
976190337 4:82480886-82480908 CAGTGTGAGCAACTGAAAGACGG + Intergenic
977547858 4:98406362-98406384 CAGTGAAACCTAAGGAAGGCTGG + Intronic
977584600 4:98760806-98760828 CAGTGGGACATAAGCCAAGAAGG - Intergenic
977668502 4:99668874-99668896 CAGTACGACCCAAAGAAAGATGG - Intergenic
977766065 4:100799104-100799126 CAGTTTGCCCTGATGAAAGAAGG - Intronic
977913663 4:102565859-102565881 CAGTATGAGCTAAGGAGATAGGG + Intronic
978769272 4:112437010-112437032 CAGTGAATCCTAAGGACAGAAGG + Intronic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
981122848 4:141072456-141072478 CAGTGGGACAAAAGGAAAAAAGG + Intronic
981252257 4:142617375-142617397 CCCTGTGACCTAAGGGAAGGTGG - Intronic
981576897 4:146214900-146214922 CAGTGAAACCTAAGGCAGGAGGG + Intergenic
983029445 4:162781195-162781217 CACTGAGACCTAAAGGAAGAGGG - Intergenic
984201715 4:176729628-176729650 AAGTGTCAGCTAAGGAAAGGAGG - Exonic
985289899 4:188376801-188376823 CAATGTGACCTAAGAAAGCAAGG + Intergenic
987732671 5:21797439-21797461 TAGTGTCAGCTAAGGAAACATGG - Intronic
989362348 5:40617040-40617062 CAGAGTTATATAAGGAAAGATGG - Intergenic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
990404048 5:55469901-55469923 CAGAGTGACCTAAACAAAGTAGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
996484555 5:124016766-124016788 CTGTGTGAACTAAGGAACAAAGG + Intergenic
997445065 5:133934574-133934596 GAGTGTGACTGAATGAAAGACGG - Intergenic
998376299 5:141692961-141692983 CTGTGTGACCTTGGGAAAGCAGG + Intergenic
999223823 5:150003327-150003349 CAGTGTAGCATAATGAAAGAAGG + Intronic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1001348001 5:170925322-170925344 CTGTGTGACTTAACGCAAGATGG - Intronic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1006484593 6:34328260-34328282 CAGTTAGACCTAAATAAAGATGG - Intronic
1007134439 6:39507735-39507757 CAGTGTGATGGAAGGAAGGAAGG - Intronic
1007987775 6:46224474-46224496 CAGTTTGACCAAAACAAAGAAGG - Intronic
1008107056 6:47450555-47450577 AAGTATGAATTAAGGAAAGAAGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009296816 6:61961360-61961382 GAGTGTGAAAGAAGGAAAGAAGG + Intronic
1009785495 6:68333110-68333132 ATGAGTGAGCTAAGGAAAGAAGG - Intergenic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1013360520 6:109390023-109390045 CAGTGTGACCTGAGGAACCTGGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1015575460 6:134666344-134666366 CTCTGAGACCTAAGGAAAGCTGG + Intergenic
1016373720 6:143399398-143399420 CAGTGTGTTCTAAGAACAGAGGG + Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1016610955 6:145989026-145989048 CAGTGAGCCCTAAAGAACGACGG - Intergenic
1021829596 7:24591103-24591125 CAGTGGGACCTCAGGAGGGAGGG + Intronic
1023788887 7:43736412-43736434 CAGCGTGAGATAAGGAAGGAAGG + Intergenic
1024693156 7:51825031-51825053 CAATGTGACAAAAGGAAAAAAGG - Intergenic
1026773613 7:73217542-73217564 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027014472 7:74770936-74770958 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1027073561 7:75175021-75175043 CAGGGTGACCTCTGGAATGATGG + Intergenic
1028604785 7:92643981-92644003 CAGAGGGACCTAAGGAAACCAGG + Intronic
1028728340 7:94115392-94115414 CAGTGTGTTGTAAGGAAAGATGG + Intergenic
1029229520 7:99054696-99054718 CAGAGTGACTTAAGGAGGGAAGG + Intronic
1031501237 7:122519690-122519712 CAGTGTGACCTAAGGATAGCTGG - Intronic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1035383253 7:158453607-158453629 CTGGGTGAGCTCAGGAAAGAGGG + Intronic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1036681466 8:10877572-10877594 CAGGGTGACCTCTGGAAAGCAGG + Intergenic
1036712354 8:11088573-11088595 CTTTGTCACCTAAGGAAGGAAGG - Intronic
1038444319 8:27592939-27592961 CTTTGTGACCTAAGGAAGGCGGG + Intergenic
1040832421 8:51692090-51692112 CAGGGTGGCCTAGGTAAAGAGGG - Intronic
1042334973 8:67620452-67620474 CAGTGTGATTTAGGGAAGGAAGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1043006971 8:74831794-74831816 AGGTGTGAGTTAAGGAAAGAGGG + Intronic
1043449002 8:80348236-80348258 CAGTATGCCCCAAGGAAAGATGG - Intergenic
1045135663 8:99214705-99214727 TAGTGTGACAGAAGTAAAGATGG - Intronic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1052444458 9:28542378-28542400 CAGAGAGGCCTAAGGAAAGATGG + Intronic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1061243165 9:129386167-129386189 CTGTGTGGCCTCAGGAAAGCAGG + Intergenic
1061912958 9:133734667-133734689 AAGTGAGACCTGAGGAAAGTGGG + Intronic
1186606418 X:11097691-11097713 CACAGTGATCTGAGGAAAGAGGG - Intergenic
1187358976 X:18606659-18606681 GACAGTGACCTCAGGAAAGAGGG + Intronic
1188448639 X:30285296-30285318 CAGTCTGAGCTAAGAAAAGTAGG + Intergenic
1188634751 X:32415289-32415311 CAGTGTGGCTTAAGAAATGATGG + Intronic
1192680882 X:73252895-73252917 CAGGTTGAACTAAGGTAAGAGGG + Intergenic
1199412933 X:147546069-147546091 CACTGTGAACCAAAGAAAGAGGG + Intergenic
1200818114 Y:7554854-7554876 CTGTGTGACCCACGGAGAGAAGG + Intergenic