ID: 1002433134

View in Genome Browser
Species Human (GRCh38)
Location 5:179215603-179215625
Sequence AGTCACAAGCCTCCAAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002433131_1002433134 17 Left 1002433131 5:179215563-179215585 CCCATTAAAAGTTCAGTAAAGAA 0: 1
1: 0
2: 4
3: 60
4: 506
Right 1002433134 5:179215603-179215625 AGTCACAAGCCTCCAAGGATAGG No data
1002433132_1002433134 16 Left 1002433132 5:179215564-179215586 CCATTAAAAGTTCAGTAAAGAAA 0: 1
1: 0
2: 5
3: 53
4: 579
Right 1002433134 5:179215603-179215625 AGTCACAAGCCTCCAAGGATAGG No data
1002433130_1002433134 29 Left 1002433130 5:179215551-179215573 CCTTTCTAGAATCCCATTAAAAG 0: 1
1: 0
2: 0
3: 27
4: 261
Right 1002433134 5:179215603-179215625 AGTCACAAGCCTCCAAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002433134 Original CRISPR AGTCACAAGCCTCCAAGGAT AGG Intronic
No off target data available for this crispr