ID: 1002433560

View in Genome Browser
Species Human (GRCh38)
Location 5:179218215-179218237
Sequence GCTGCTGGTGCTCCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 381}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002433560_1002433572 20 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433572 5:179218258-179218280 CCCCACCCAGGGGAGGTCAACGG 0: 1
1: 0
2: 1
3: 16
4: 171
1002433560_1002433570 13 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433570 5:179218251-179218273 TGAGGAGCCCCACCCAGGGGAGG No data
1002433560_1002433568 9 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433568 5:179218247-179218269 AACATGAGGAGCCCCACCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 127
1002433560_1002433567 8 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433567 5:179218246-179218268 CAACATGAGGAGCCCCACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 118
1002433560_1002433574 21 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433574 5:179218259-179218281 CCCACCCAGGGGAGGTCAACGGG 0: 1
1: 0
2: 1
3: 7
4: 125
1002433560_1002433578 28 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433578 5:179218266-179218288 AGGGGAGGTCAACGGGAACAAGG 0: 1
1: 0
2: 0
3: 8
4: 147
1002433560_1002433569 10 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433569 5:179218248-179218270 ACATGAGGAGCCCCACCCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 153
1002433560_1002433563 -5 Left 1002433560 5:179218215-179218237 CCAAAGCCTGGAGCACCAGCAGC 0: 1
1: 0
2: 3
3: 53
4: 381
Right 1002433563 5:179218233-179218255 GCAGCCTCTCCTCCAACATGAGG 0: 1
1: 0
2: 4
3: 43
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002433560 Original CRISPR GCTGCTGGTGCTCCAGGCTT TGG (reversed) Intronic
900075876 1:817444-817466 GCTGCGTGTGCTCATGGCTTGGG - Intergenic
900154470 1:1198440-1198462 GGAGCTGGAGCGCCAGGCTTGGG - Intergenic
900462361 1:2807775-2807797 GCTGCTGGGACTGCAGGCCTGGG - Intergenic
901404946 1:9039436-9039458 GCGGCTGGTCCTCCACGTTTTGG + Intronic
901606523 1:10463464-10463486 GCAGCTGTACCTCCAGGCTTTGG - Exonic
902091103 1:13903932-13903954 GCTTCTGGTGCTCCTGACTGGGG - Intergenic
902176580 1:14655110-14655132 GGTGCTGCTGCTCCTGGCCTAGG + Intronic
902281888 1:15380829-15380851 ACTGCAGGGGCCCCAGGCTTTGG - Intronic
903277772 1:22232774-22232796 ACTCCTGGGGCTCCAGCCTTTGG + Intergenic
903500238 1:23796529-23796551 GCTGCAGATGGTCCAGGCTATGG - Exonic
903542674 1:24105764-24105786 GCTGCTGGGGAACCAGGCCTGGG - Intronic
904746674 1:32715726-32715748 GCTGCTTCTACTTCAGGCTTTGG + Intergenic
905637940 1:39567924-39567946 GATGCTGGTGCTCCTGGTCTGGG - Intronic
905939324 1:41850490-41850512 GCTGCTGGGGTTCCTGGTTTGGG - Intronic
906149024 1:43577147-43577169 GTGGCTGGTGCCACAGGCTTGGG - Intronic
907172963 1:52488107-52488129 GCTGGTGCTGCTCCAAGCATGGG + Intronic
907240511 1:53078506-53078528 GCAGCAGGTACTCCAGGCTGCGG - Exonic
912332810 1:108834900-108834922 TCTGCTGGGGCTCCAGGGCTAGG + Intronic
912420098 1:109536830-109536852 GGTGCTGGTGCACAAGGGTTGGG + Intergenic
912459868 1:109823531-109823553 GCTGCTGCTGCCCAAGGCCTTGG + Intergenic
912500382 1:110117989-110118011 GCTGCTGATGCCCCAGGCTGGGG + Intergenic
912722753 1:112033918-112033940 TCTCCTGGTACTCTAGGCTTTGG - Intergenic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
913250709 1:116910230-116910252 GCTGCTGGCGCTCCTGTCGTTGG + Exonic
913963180 1:143354439-143354461 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914057536 1:144180025-144180047 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
914121610 1:144786341-144786363 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
914695554 1:150075512-150075534 GCTGCTGATGCTCAATGCCTGGG + Intronic
915599785 1:156914835-156914857 GCTGTTGCTGCTCAAGGCTGGGG + Exonic
915609917 1:156983546-156983568 ACTGTTGGTGGTCCAGGCTGAGG - Intronic
915907054 1:159886629-159886651 TCTGCTGCTTCTCCAGGATTTGG + Exonic
919559351 1:199097836-199097858 GCTGCTGCTGCTGCTGGCTTGGG - Intergenic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
921029726 1:211326825-211326847 GCGGCTGCTGCTCCTGGCTGCGG - Exonic
921286256 1:213612090-213612112 GCTGCTGATGCTTCTGGCTGAGG - Intergenic
921659540 1:217784776-217784798 ACTTCTGGTTCTCCAGGCTAGGG - Intronic
921940239 1:220831398-220831420 GCTCCTGGTTCTCAAGCCTTTGG - Intergenic
922064580 1:222124521-222124543 GCTGCTGTTGGTCCAGGCTGTGG + Intergenic
923051264 1:230392881-230392903 GCTCCTGCTGCTCCAGGCTCTGG - Intronic
923782166 1:237034568-237034590 GCTGCTGCTGCTGCAGCCATTGG - Intergenic
924202863 1:241678368-241678390 TTTGCTGTTGCTCAAGGCTTAGG - Intronic
924294728 1:242574730-242574752 CCTTGTGGTGCTTCAGGCTTTGG - Intergenic
924309848 1:242728851-242728873 GCTGCTGATGATACAGGTTTTGG - Intergenic
1063347607 10:5326134-5326156 GCTCCTGGTTCTGCAGGCTCAGG - Intergenic
1064086885 10:12351654-12351676 GCTGCTGAGGCTCCAAGCTGTGG + Intronic
1064934245 10:20662385-20662407 ACAGCTGGTGCTCCAGTCTCGGG - Intergenic
1066259755 10:33717961-33717983 GATGCTGGTGCTGCTGGCCTAGG + Intergenic
1067236926 10:44458942-44458964 GCTGCTGATGCTCCAGCCTATGG + Intergenic
1067566823 10:47345629-47345651 GCTGCAGGTGCTGCAGGGCTGGG + Intergenic
1067799351 10:49348347-49348369 GGGGATGGTGCTCAAGGCTTAGG + Intergenic
1070825135 10:79386398-79386420 GCTGCGGGTGCTCCTTGCTCTGG + Exonic
1071601094 10:86959103-86959125 GCTTCAGGGGCTCCAGGCTCAGG - Intronic
1072353559 10:94582363-94582385 GCTTCTGGTGATCCAAGTTTGGG + Intronic
1073225720 10:101916905-101916927 GCTCCTGGTTCTCCAGTTTTTGG + Intronic
1075729841 10:124629556-124629578 GCTGCAGGGGCCCCAGGCTCTGG + Intronic
1075867566 10:125739268-125739290 GCTGCTGGTATGCCAGGCTTCGG + Intronic
1076469631 10:130709571-130709593 GCTGCAGGTGCTGCAGGCAGCGG - Intergenic
1077177640 11:1197897-1197919 GCGGCTGGTGTTGCAGGCTGCGG - Intronic
1077532682 11:3104570-3104592 GCTGCGGGTGCTCCAGGGGTGGG - Intronic
1081153832 11:39664682-39664704 GCTCCTGGTTCTCAAGCCTTTGG + Intergenic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082669044 11:56010985-56011007 ACTCCTGGTTCTCCAGCCTTTGG - Intergenic
1082817902 11:57522535-57522557 GCTGATGGTGATCTGGGCTTGGG - Intergenic
1082842926 11:57704047-57704069 GCTGCTGCTGCTGCTGGCCTGGG + Exonic
1082996890 11:59262163-59262185 TCTGCTGGTGCTGCAGGCGGGGG - Intergenic
1084151661 11:67290362-67290384 GCAGCTGGTGCTCCAGTATCGGG + Exonic
1084215701 11:67645808-67645830 GCTGCTGGGGCCCAAGGCCTCGG - Exonic
1084548895 11:69828978-69829000 GGTGCTGGGGCCTCAGGCTTTGG + Intergenic
1084876266 11:72135976-72135998 GCAGCTGCTGCTTCTGGCTTTGG + Exonic
1086138464 11:83467276-83467298 TCTGTTAGTGCTCCAGACTTGGG - Intronic
1086319207 11:85627808-85627830 GCTGCTGTTGCTCCTGCCTGAGG - Intronic
1087154138 11:94884549-94884571 ACTGCTGCTGCTTCAGCCTTAGG + Intergenic
1089424405 11:118359653-118359675 GCTGCTGGCACTTCAGGCTCTGG + Exonic
1089605960 11:119641480-119641502 GCTGCAAGTGGTCCAGGCTGGGG - Intronic
1090137670 11:124215458-124215480 GCTGCAAGTGCTAAAGGCTTTGG - Intergenic
1090138421 11:124225435-124225457 GCTGCAAGTGCTGAAGGCTTTGG - Intergenic
1090141225 11:124265635-124265657 GCTGCAAGTGCTGAAGGCTTTGG - Exonic
1090147265 11:124338965-124338987 ACTGCAGGTGTTCAAGGCTTTGG + Intergenic
1090156105 11:124440360-124440382 GCTGCAGGTGCTGAAGGCTTTGG + Exonic
1090157947 11:124461264-124461286 GCTGCAGGTGCTGAAGACTTTGG - Intergenic
1090167900 11:124570820-124570842 GCTGCAGGTGCTGAAGGCTTTGG - Exonic
1090949782 11:131463473-131463495 GCCGCTGGGGCCCCAGGCTTGGG + Intronic
1091837354 12:3595182-3595204 GCTGCTGGGGCAGGAGGCTTAGG + Intergenic
1091919671 12:4294245-4294267 GCTGTGAGGGCTCCAGGCTTGGG + Intronic
1092844122 12:12568311-12568333 GCTCCTGGTGGACCAGGCTGAGG - Intergenic
1094192749 12:27713510-27713532 ACTCCAGGTGCTCCAGCCTTTGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095886069 12:47189892-47189914 ACTTCTGCTGCTCCAGGCTTGGG + Intronic
1098757414 12:74383548-74383570 GTTGTTGGTGCTACAGGCATGGG + Intergenic
1101414763 12:104499438-104499460 CCAGTTGCTGCTCCAGGCTTAGG - Intronic
1101518072 12:105455504-105455526 GATGCTGGTGCTCTGGGCTGTGG + Intergenic
1101773783 12:107775596-107775618 GCTGCTGGAGCGCCAGGCCTGGG + Exonic
1103410738 12:120710150-120710172 GCTGCTGCTGCCACAGGGTTAGG - Intergenic
1103907449 12:124334951-124334973 GGTGCCGGTGCTCGGGGCTTTGG + Intronic
1104714873 12:131009960-131009982 GCTGCGGGGGCTCCTGGCATGGG + Intronic
1104941684 12:132398216-132398238 GCTGCCAGGGCTCCAGGCTGAGG + Intergenic
1105245432 13:18645870-18645892 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1105247565 13:18666754-18666776 GCTTCAGGTGCTCCCGGCTGGGG - Intergenic
1105284100 13:18990656-18990678 GCTGATGATGCTGCAGTCTTGGG + Intergenic
1105853146 13:24353508-24353530 GCTTCTGGTTCTCCAGTCTTTGG - Intergenic
1106380849 13:29237459-29237481 TCTGCTGCTTCTCCAGGCTGAGG + Intronic
1106605349 13:31223748-31223770 GCTGATTGTGTTCCAGACTTGGG - Intronic
1108002490 13:45916937-45916959 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1108112357 13:47089104-47089126 GCTGATGGTGCTCTAGAGTTTGG + Intergenic
1110809103 13:79791818-79791840 GCTGGGGGTGGTCCAGGCTTGGG + Intergenic
1111463441 13:88576187-88576209 GCTGCTCTGGCTCCAGCCTTAGG - Intergenic
1111659615 13:91192970-91192992 GCTTCTTGAGATCCAGGCTTGGG - Intergenic
1112482592 13:99790747-99790769 GCTGCTGGTCCTTCAGGCAGTGG + Intronic
1113767996 13:112892864-112892886 GCTGCTGCTGCTCCAGGGAGCGG + Intergenic
1113824727 13:113242654-113242676 GTAGCTGGTGCTACAGGCTCAGG - Intronic
1113958525 13:114112575-114112597 GATGCTGGTGCTGCAGGTATGGG + Intronic
1115746261 14:36440827-36440849 GCTGCAGCTGCTCCAGTCCTAGG - Intergenic
1116776903 14:49191646-49191668 GCTACTGGGACTCCAGGATTAGG + Intergenic
1117790061 14:59331239-59331261 CCTCCTGGTGCTCCAGGCGAGGG - Exonic
1118765435 14:68906558-68906580 GCAGCTGCTGCTCCAGGCCCTGG - Intronic
1119485082 14:74981692-74981714 GCTCCTAGGGGTCCAGGCTTTGG - Intergenic
1121332361 14:93057732-93057754 GCTGCCTGTGCTGCAGGCTGGGG - Intronic
1121735177 14:96213417-96213439 GCTCCTGATGCTGGAGGCTTAGG - Intronic
1121906701 14:97752692-97752714 GCTGCTGGTCCTGCTGGCTCTGG - Intronic
1122480742 14:102045830-102045852 GCTGCTGCTGCTGCTGGTTTGGG - Intronic
1122500425 14:102194474-102194496 GCTGCTGCTGCTTCTGGTTTGGG + Intronic
1122636290 14:103131283-103131305 GCTGCTGCTGCTGCAGGCCGTGG - Intronic
1122746656 14:103901084-103901106 GATGCTGGTGCTCCAAGCCCAGG - Intergenic
1122943944 14:104996532-104996554 CCTGCTGGGCCTCCAGACTTTGG - Intronic
1123683119 15:22776883-22776905 GCTGCTGTTTTTCCAGGCCTTGG + Intronic
1124140713 15:27074546-27074568 CCTCCTGGTACTCCAGCCTTGGG - Intronic
1124335315 15:28851297-28851319 GCTGCTGTTTTTCCAGGCCTTGG + Intergenic
1124686857 15:31790323-31790345 GATGCTGATGCTGCAGGCCTAGG + Intronic
1125765255 15:42131218-42131240 CCCGCTGTTGATCCAGGCTTTGG - Intergenic
1126580669 15:50239837-50239859 GCTGCTGATGCTGCTGGCTCAGG - Intergenic
1126851673 15:52801031-52801053 GCTGCTGCTGCTCTTGGGTTAGG + Intergenic
1127974047 15:63984122-63984144 GCTGGTGGGGATCCAGGTTTGGG + Intronic
1128052442 15:64675887-64675909 GCTGCTGCTGCTCTAAGCTCTGG - Exonic
1128231548 15:66038996-66039018 CCTGCTGGTGCTGCTGGCCTGGG - Intronic
1128331016 15:66755753-66755775 TCTGCTGGTACTCCAGGGTCTGG + Intronic
1128548308 15:68581853-68581875 GCTGCTGCTTCTCCAGGCAGAGG + Intronic
1128575352 15:68770585-68770607 GCTGCTGGTGCAGCAGGGCTAGG - Intergenic
1129458367 15:75687695-75687717 GCTGCTGGAGGTGCAGGCCTCGG - Exonic
1129725417 15:77899170-77899192 GCTGCTGGAGGTGCAGGCCTCGG + Intergenic
1133139232 16:3732084-3732106 GCTGTAGGTGCTGCAGCCTTCGG + Intronic
1133486783 16:6227327-6227349 GTTGCCGGTGCTGCAGGCTTTGG + Intronic
1134810892 16:17166211-17166233 GCAGCAGCTGCTCCAGGCATGGG - Intronic
1135851364 16:25966955-25966977 GATGCTGATGCTGCAGGCCTGGG - Intronic
1136088544 16:27902573-27902595 GCCGCTGGTGCAGGAGGCTTTGG + Intronic
1136298033 16:29314700-29314722 GCTGCTGGACCTCATGGCTTGGG + Intergenic
1136398278 16:30004754-30004776 GCCGCTGGGGCTCCTGGCTCAGG + Intronic
1136413536 16:30090813-30090835 GCTCCCGGTTCTCCAGGCTCAGG + Exonic
1136621539 16:31432090-31432112 GCTGCTGGAGCCTCAGGCTGGGG + Intergenic
1136628116 16:31473857-31473879 GCCGCCGGGGCTGCAGGCTTTGG - Exonic
1137381927 16:48007386-48007408 GCTGCTGTTGCTACAGTATTTGG + Intergenic
1138130877 16:54478927-54478949 GCTGCTGGAGCTGCAGGTGTTGG - Intergenic
1138368900 16:56508512-56508534 GCTGCTGGTTTTCCAGGATTGGG - Intronic
1138704623 16:58902174-58902196 GCTCCAGGTGCTGCAGGTTTTGG + Intergenic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139559869 16:67735115-67735137 GCTGCTGCTGGCCCATGCTTGGG + Intronic
1139950178 16:70664685-70664707 TCTTCTGGTGCTCCAGGCTCAGG + Exonic
1140146921 16:72320095-72320117 GCTGCTTCTGCTCCAGGCTGTGG - Intergenic
1141487832 16:84352741-84352763 GCTGATCTTCCTCCAGGCTTTGG - Intergenic
1142128433 16:88421460-88421482 GCGGCATGTGCTCCAGGCCTTGG - Intergenic
1142556594 17:782423-782445 GCTGCAGGTGGTCCAGGCTTGGG + Exonic
1142803325 17:2358580-2358602 GCAGCTGGGACTACAGGCTTGGG - Intronic
1143025698 17:3940942-3940964 CCTCCTGGGGCTCCAGGCTGTGG + Intronic
1143727532 17:8859714-8859736 GCTCTTGGTTCTCCAGCCTTCGG + Intronic
1144180170 17:12744368-12744390 GCTGCTGCTGCTGCTGGCTGAGG - Exonic
1144720288 17:17464433-17464455 GATGCTGGTCCTCCTGTCTTTGG + Intergenic
1147582917 17:41636993-41637015 GCTGCCGGGGCTGCAGGCCTGGG - Intergenic
1147721400 17:42541819-42541841 GCTGCTGCTGCTGCTGGTTTTGG - Intronic
1147951592 17:44110855-44110877 GCTGCTGGTGCCCAAGGCTCAGG - Intronic
1148475058 17:47923149-47923171 GCTGATGATGCTCCCGGCTGGGG - Exonic
1148688084 17:49512003-49512025 GCTGCTGGTCATGCAGGCTCTGG - Exonic
1148712268 17:49690441-49690463 CCTGCTGATTCTTCAGGCTTCGG + Intergenic
1150069740 17:62140456-62140478 GCTGGAGGTGCTCCAGGCGCGGG - Intergenic
1150599336 17:66637037-66637059 CTTGCTGGTTCTCCAGACTTAGG + Intronic
1152361443 17:79834971-79834993 GCGGCGGGTGCTCCAGGCAAAGG - Exonic
1152601310 17:81263605-81263627 GCTGCTTGTGCTCAAGGCAGTGG - Intronic
1152716630 17:81903474-81903496 GCTGCCTGGGCCCCAGGCTTGGG - Intronic
1153818085 18:8808224-8808246 GCTGCTGATGCTGCAGGCCGGGG - Intronic
1154287461 18:13073641-13073663 TCTGCTGGTGCTCTAATCTTGGG - Intronic
1154441275 18:14392367-14392389 GCTTCAGGTGCTCCTGGCTGGGG + Intergenic
1154443513 18:14414077-14414099 GCTTCTGGAGGTCCAGCCTTAGG - Intergenic
1155065553 18:22266073-22266095 GCCGCTCATGCTCCAGGCTTTGG + Intergenic
1157132185 18:45017159-45017181 ACAGCCAGTGCTCCAGGCTTTGG + Intronic
1157132792 18:45023006-45023028 GCTACTGGTTATCCAGGCCTGGG - Intronic
1158695163 18:59697255-59697277 GCTGCTGCTGCTCCTGGCGTTGG - Exonic
1160012445 18:75116357-75116379 GCAGCTGGAGCTACAGGCTGTGG - Intergenic
1160771732 19:835133-835155 GCTTCTGGTGCCCCCGGCTCGGG + Intergenic
1161045571 19:2132629-2132651 GCTCCTGGTGACCCAGGCGTCGG - Intronic
1161065534 19:2235707-2235729 GCTGCGGGTGCCCCGGGCTGCGG + Intronic
1161109916 19:2463261-2463283 GCTCCTGGAGATCCAGGCTCCGG - Intergenic
1161166674 19:2791517-2791539 GCTGCGGGACCTGCAGGCTTGGG - Intronic
1161531674 19:4793387-4793409 GCTTCAGGTGCTCCTGGCTGGGG - Exonic
1161743288 19:6038797-6038819 GCTGCTGGTGCTCTTGGTTTTGG - Intronic
1162042623 19:7979788-7979810 GCTGCTGCTGAGCCAGGGTTTGG + Intronic
1163476446 19:17528786-17528808 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1163476538 19:17529430-17529452 GCTGCTGGAGCTCCAGCCATTGG + Intronic
1163550768 19:17965489-17965511 GCTCCTGGTGGTCCAGGCAGGGG + Intronic
1163556685 19:17997324-17997346 GCTGACGTTGCTCCAGGCTGGGG - Intronic
1163597981 19:18231534-18231556 GCTGCTGGAGGGCCAGGCTGGGG + Intronic
1164552784 19:29225671-29225693 GCTCCAGGTGCTGCAGGCTTTGG - Intergenic
1165636467 19:37344391-37344413 GATGCTGGTGCTGCAGGTTCAGG + Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1167180296 19:47898048-47898070 GGTGCTAGCGCTCAAGGCTTTGG - Intergenic
1167425347 19:49427346-49427368 GCTGCAGGTGTTCCTGGTTTGGG - Exonic
1167867976 19:52343735-52343757 GCTGGTGTTGGTCGAGGCTTCGG + Intronic
1168233694 19:55048808-55048830 TCTGCTGGTGCATCAGGCTGGGG - Intronic
1168485913 19:56761702-56761724 GCTGCTTGTGATGAAGGCTTTGG - Intergenic
1202697020 1_KI270712v1_random:132698-132720 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
925093637 2:1175970-1175992 TCTCCTGGTTCTTCAGGCTTTGG + Intronic
925386239 2:3463712-3463734 GCCACTGATGCTCCAGGCTGAGG - Intronic
925905044 2:8535211-8535233 GCTGCAGTGGCTCCAGGCCTGGG - Intergenic
925920158 2:8632745-8632767 GCTGGAGCTGCTCCAGGCCTTGG - Intergenic
926348828 2:11976624-11976646 GCTGCTGGTTTTCCTGGGTTGGG + Intergenic
926419411 2:12682136-12682158 GCAGCAGGTGCTCAAGGCTGCGG - Intergenic
927217731 2:20677955-20677977 GCTGCTGCTGCCCCAGGCCAGGG - Intergenic
927600518 2:24436330-24436352 GCAGCTGGTGGTCCAGCCCTGGG + Intergenic
927645327 2:24873624-24873646 GCTGCTGCTACTCCAATCTTTGG + Intronic
927708610 2:25311956-25311978 GCTGCTGCTGCTCTGGGCTGCGG - Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928325876 2:30319151-30319173 GCTGCTGGTGCTTGAGTCTTGGG - Intronic
928443739 2:31314906-31314928 GCTGCTGGAGGAGCAGGCTTGGG - Intergenic
929828564 2:45329392-45329414 GCTGCATGTGCTTCAGGCTTGGG + Intergenic
930233482 2:48866254-48866276 GCTGCTGCTGCTCCTGACTGTGG + Intergenic
931731985 2:65161287-65161309 GCTGCTGATGCAGCAGGCTTGGG + Intergenic
932000172 2:67877738-67877760 GCTGCTGTTGCTGCTGCCTTTGG - Intergenic
932480730 2:72037481-72037503 GCTGCGGATGCTCCAGGGGTAGG + Intergenic
932637984 2:73409873-73409895 GCTCCTGGTTCTCAAGCCTTTGG - Intronic
934278181 2:91589712-91589734 GCTGCTGCTGCTGCTGGCCTGGG + Intergenic
935471181 2:103462824-103462846 GCTGCTGATGCTTCTGGTTTTGG + Intergenic
935672044 2:105564278-105564300 GCTGCTGCTGCGCTGGGCTTCGG - Intergenic
937644419 2:124250291-124250313 GCTGCTGGTGCTCCTGGTTGGGG + Intronic
938071790 2:128312269-128312291 GCTCCTGGCCCTCCAGGCTGAGG + Intronic
940215691 2:151301174-151301196 GCTCCTGGTTCTCAGGGCTTTGG + Intergenic
940985291 2:160046218-160046240 GCTGCTGCTGCTTCAGCCTTTGG + Intronic
941628889 2:167862327-167862349 GCTTCTGGTTCTCGAGCCTTTGG - Intergenic
941649625 2:168079590-168079612 GCTGCTGTTGCCCCAGTCTATGG - Intronic
944344068 2:198639326-198639348 GCTCCTGGTTCTTCAGCCTTTGG + Intergenic
946252655 2:218423019-218423041 CGTGCTGATGCTCCAGGCTCTGG - Intronic
947156231 2:227164774-227164796 CCTGCTGGTGCTCCTGGCGGCGG + Exonic
947491296 2:230596771-230596793 AATGCTGGTGCTCCAGTGTTGGG - Intergenic
947716237 2:232340269-232340291 GCTGTTGCTGCTGCTGGCTTTGG - Intronic
948249942 2:236519160-236519182 GCTGCTGCTCCTCCAGCCCTGGG - Intergenic
948531198 2:238606722-238606744 GCTGCTGCTGCTGCGGGGTTGGG - Intergenic
948590549 2:239047120-239047142 GCTGCTGGGGGACCAGGCTGGGG - Intergenic
948606010 2:239135635-239135657 GATGCTGGAGCTCCACTCTTGGG + Intronic
948752594 2:240141178-240141200 GCTGCTGGTGTCCCAGGGTGGGG - Intronic
948795934 2:240402124-240402146 GCTGCTGGGGCTCCACCCTGAGG + Intergenic
1168979837 20:1995006-1995028 GCTGCTGCTGGTCCAGGCCAAGG - Intergenic
1170331196 20:15212816-15212838 GCTGCTGATGCTGCTGGCCTAGG - Intronic
1171255256 20:23685413-23685435 GCTGCTGCAGCTGAAGGCTTGGG + Intergenic
1172118227 20:32583949-32583971 GCTGCTCCTGCGCCAGGCTGCGG + Intronic
1172289970 20:33769265-33769287 GATGCTGGTGCTGCTGGCCTGGG - Intronic
1172603749 20:36200912-36200934 CCTGCGGCTGCTCCAGGCTCAGG - Intronic
1173795218 20:45855111-45855133 GCTGCTGGGCCACCAGGGTTGGG + Intronic
1173818767 20:46007596-46007618 GCTGCTGGTGTGGGAGGCTTGGG + Intergenic
1174077605 20:47948972-47948994 GCTGCTGCTGCTTCATGCATTGG + Intergenic
1174153573 20:48502688-48502710 GCTGCTGGTGTTCAAGTCTGAGG - Intergenic
1174180222 20:48669748-48669770 GCTGCCTGTGTGCCAGGCTTTGG - Intronic
1174858921 20:54071823-54071845 GCTCCTGAGCCTCCAGGCTTGGG - Intergenic
1175166053 20:57045473-57045495 GCTGCTGATGCTGCAGGCCCGGG - Intergenic
1175209267 20:57339475-57339497 GATGCTGATGCTCCTGGCTTAGG - Intronic
1175832402 20:61973296-61973318 GCTGCTCGTGCCCCAGGCCTGGG + Intronic
1176328284 21:5521097-5521119 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176387515 21:6146144-6146166 GCTGCTGTCTCTCCAGACTTGGG + Intergenic
1176399473 21:6299854-6299876 GTAGCTGGGGCTACAGGCTTGGG + Intergenic
1176437684 21:6689250-6689272 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176452577 21:6877161-6877183 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1176461946 21:7016320-7016342 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176485507 21:7398098-7398120 GTAGCTGGGGCTACAGGCTTGGG - Intergenic
1176830750 21:13742210-13742232 GCTTCTGGAGGTCCAGCCTTAGG + Intergenic
1176832956 21:13763855-13763877 GCTTCAGGTGCTCCTGGCTGGGG - Intergenic
1178531221 21:33377844-33377866 GTTGCTGGAAGTCCAGGCTTTGG - Intergenic
1178941281 21:36908856-36908878 TCTCCTGAGGCTCCAGGCTTAGG + Intronic
1179164698 21:38926237-38926259 GCTGGGTGTGCTCCAGGCTCCGG - Intergenic
1179735957 21:43392104-43392126 GCTGCTGTCTCTCCAGACTTGGG - Intergenic
1180060383 21:45381997-45382019 GCTGCTGTGGCCCCAGGGTTTGG + Intergenic
1180078214 21:45473812-45473834 GCTGCTTGAGCTCCAGATTTCGG - Intronic
1181495256 22:23283964-23283986 GCTGCCGGTGCTGCAGGCACAGG - Exonic
1182003621 22:26941087-26941109 TCTGCTGCTGCTCCAGCCTTTGG + Intergenic
1183213242 22:36463861-36463883 GCAGCTGGTGTTCCAGGCATCGG + Intergenic
1183518760 22:38283962-38283984 GCTGTTGGTGCCCAAGGCTAGGG + Intergenic
1185258115 22:49848050-49848072 GCGGCAGCTGCTCCAGGCTGCGG - Intergenic
950045727 3:9947630-9947652 GGTGCTGGTGCTCGTGGCTTCGG - Exonic
950143466 3:10631549-10631571 GCTACTTGAGGTCCAGGCTTTGG + Intronic
950183180 3:10929136-10929158 GCTCCTGGTGGCCCAGGCTCTGG - Intronic
950477836 3:13224950-13224972 CCTGCTGGGCCACCAGGCTTGGG - Intergenic
950883823 3:16345617-16345639 GCTCCTGGTTCTCAGGGCTTGGG + Intronic
950918340 3:16667732-16667754 GATGCTGATGCTCCTGGCCTGGG - Intronic
951107560 3:18762709-18762731 GGTGGTGGTGACCCAGGCTTGGG - Intergenic
951110815 3:18801859-18801881 GCTGCTGCTGCACTATGCTTCGG - Intergenic
952902249 3:38117991-38118013 GCAGCTGGTGCTCCAAGCACAGG + Exonic
952946055 3:38478425-38478447 GCTGCTGGAGATCAAGGCTCGGG + Exonic
953552168 3:43911839-43911861 GCTGATGGGGAACCAGGCTTTGG - Intergenic
954316723 3:49805537-49805559 GCAGCTCCTGCTCCTGGCTTGGG - Intronic
955402203 3:58600375-58600397 GCTGCTCATGCGACAGGCTTTGG + Intronic
955736306 3:62042138-62042160 GCTTCTGGGGCTCTAGGATTTGG + Intronic
956737408 3:72248291-72248313 GATGCTGGAGGGCCAGGCTTGGG - Intergenic
958960853 3:100508274-100508296 GCTGCAGTTGCTTCAGTCTTGGG - Intronic
958964154 3:100539616-100539638 GCTCCTGGTCCTCAGGGCTTTGG - Intronic
960208361 3:114930582-114930604 GCTGCAGGTGGTGCCGGCTTGGG - Intronic
960691049 3:120347334-120347356 ACTCTTGGTGCTCCAGCCTTAGG - Intronic
961213266 3:125141659-125141681 GATGCTGGGGCTGCAGGCTGCGG + Intronic
961786724 3:129351993-129352015 CCTGCTGGGCCACCAGGCTTGGG + Intergenic
963799026 3:149658465-149658487 GCTCCGGGTGCTGCAGGCCTCGG - Intronic
964264946 3:154885034-154885056 GTTACTGGTGTTCCAGACTTTGG - Intergenic
964314015 3:155424295-155424317 GCTGCTCGTGCTGCAGGGTCTGG - Intronic
964659445 3:159104167-159104189 ACTGCTGGTGATCCAGTCTCTGG + Intronic
965234274 3:166095315-166095337 TATGTGGGTGCTCCAGGCTTGGG - Intergenic
966394917 3:179492601-179492623 GGTGCTGGTGTACTAGGCTTGGG - Intergenic
967218840 3:187232281-187232303 GATGCTGGTGTTTCAGGCCTTGG + Intronic
967805222 3:193709763-193709785 GGTGCTGGTGCTACGGGCTTGGG + Intergenic
968509606 4:989648-989670 GCTGCTGGTGCTGCTGGCGCTGG - Exonic
969032568 4:4226624-4226646 GCTGCTGCTGCTGCTGGCCTGGG - Exonic
969278369 4:6152356-6152378 GGAGCTGGGGCTACAGGCTTAGG - Intronic
972144037 4:35999112-35999134 GATGCTGGTGCTTCTGGCTCAGG - Intronic
972573160 4:40328953-40328975 GCTAATGGTGCTCCAGGCAGAGG + Intergenic
972671641 4:41217729-41217751 GTAGCTGGTACTACAGGCTTGGG - Intergenic
976217315 4:82727517-82727539 ACAGCTGCTGCTCCATGCTTTGG + Intronic
976649828 4:87422641-87422663 GCAGCTGGCGCTGGAGGCTTCGG + Exonic
976813643 4:89122564-89122586 GCAGCTGGGTCTCCAGGCCTGGG - Intergenic
976955056 4:90886112-90886134 GCTGCTGGTACAACAGGATTGGG + Intronic
977435177 4:96986203-96986225 CCTGCTGCTTCTCCAGGGTTTGG + Intergenic
979251463 4:118571031-118571053 GCTGCAGGTGTTCCATGCTGTGG + Intergenic
982035211 4:151339254-151339276 GAGGATGGTGCTCCAGGCTGAGG - Intergenic
985763799 5:1765820-1765842 GCTGCTGGAGCTCCAGATGTGGG + Intergenic
986393725 5:7307418-7307440 GCTGCTGTTTTTCCAGGCCTTGG + Intergenic
986563507 5:9086655-9086677 GCTAATGTTGCTCCAGGCTTTGG - Intronic
986820767 5:11464428-11464450 GCTGCAGGTGCTCTAACCTTGGG - Intronic
986934257 5:12863658-12863680 GCAGCTGGGGCTACAGGCTTGGG + Intergenic
989215819 5:38903262-38903284 GCTGCTGGTCCCCAAGGCTGCGG + Intronic
990459372 5:56016898-56016920 GATGCTGGTGCTGCAGGTCTGGG + Intergenic
990855948 5:60266515-60266537 GCTGCTGCTGCTTCACCCTTGGG + Intronic
993606432 5:89995747-89995769 GCTCCTAGTTCTCCAGCCTTTGG + Intergenic
994067119 5:95555462-95555484 GCCGCCTGTGCTGCAGGCTTTGG + Intronic
996693299 5:126364895-126364917 GCCCCTGGTGCTCCAGGTGTGGG + Intronic
998981357 5:147706289-147706311 GTTGCTGGTTCTCCAGTCTTGGG - Intronic
999447536 5:151652144-151652166 GCTGCTGCTCCTCCAGGCTTGGG + Intergenic
1001083307 5:168682518-168682540 GATGCTGGTGCTGCTGCCTTGGG + Intronic
1001639537 5:173235011-173235033 GCTGCTGCTGTTCCAGGTTTAGG + Exonic
1001832763 5:174803366-174803388 GATGCTGGTTCTCAAGGCTTTGG + Intergenic
1001942121 5:175748136-175748158 CCTGCTCGTGCTCCAGATTTTGG - Intergenic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1003336277 6:5175886-5175908 GCTGCTGCTGATCCTGGCCTAGG + Intronic
1004122353 6:12836634-12836656 GCTGAATGTGCTGCAGGCTTAGG - Intronic
1004673713 6:17821701-17821723 GATGCTCATGCTCCATGCTTTGG - Intronic
1006275432 6:33001486-33001508 GCTGCTTCTGCACTAGGCTTGGG - Intergenic
1006425381 6:33959971-33959993 GCTCCAGGAGCTCCAGGCTGAGG - Intergenic
1006519581 6:34563495-34563517 GTTGGGGGTGCTGCAGGCTTAGG - Intergenic
1007809403 6:44475685-44475707 GCTGCTGGAGCTGCGGGCTCTGG - Intergenic
1007917115 6:45571614-45571636 GCTGCTGGTCCTTCATGTTTCGG - Intronic
1008521256 6:52363248-52363270 GCTGTGGGTGCTCCAGGCACTGG + Intronic
1011603512 6:89081102-89081124 GCTGCTGGAGCGCGAGGCTGGGG - Exonic
1012963084 6:105643691-105643713 GTTGCTGGTGCTTCAGACCTTGG + Intergenic
1013667721 6:112365869-112365891 GCTTCAGGTGCTCCTGGCTAGGG + Intergenic
1014073920 6:117215301-117215323 GCTTCTGGTGCTCCAGACCTTGG - Intergenic
1014216656 6:118758250-118758272 GCTCCTGGTTCTCAAGCCTTTGG + Intergenic
1015550993 6:134412325-134412347 GCTTCTGATTCTGCAGGCTTGGG + Intergenic
1015924324 6:138294177-138294199 GCTGCTGGTGATAGAGGCCTGGG - Intronic
1018005377 6:159617293-159617315 GCTGCTGGTGGTCCAAGCTATGG + Intergenic
1018514152 6:164560865-164560887 GAGGATGGTGCTCTAGGCTTTGG + Intergenic
1018633921 6:165843913-165843935 GCTCCTGCTGCTCCAGGTGTGGG - Intronic
1019060633 6:169255032-169255054 GCTGCTGCTTCTCCTGGGTTGGG + Intergenic
1019217216 6:170451703-170451725 GCTGCTGCTGCTCCAGGCAAGGG - Intergenic
1021477646 7:21080666-21080688 GCTCATGGTGCTGGAGGCTTGGG + Intergenic
1021746067 7:23742440-23742462 GCTGAGGCTGCTCCAGACTTGGG + Intronic
1022285814 7:28955904-28955926 GCTGCTGGTGCTCCTGGCCTTGG - Exonic
1022411255 7:30140087-30140109 GCAGCTGGTGCTCCATGCCTAGG - Intronic
1023132491 7:37016676-37016698 GCTGCTGGCGGTGCAGGCCTTGG - Intronic
1023534618 7:41195076-41195098 GCTCCAGGTTCTCCAGCCTTCGG - Intergenic
1024279917 7:47710372-47710394 TCTGCTGGTGCTGCAGGAGTTGG - Intronic
1024610198 7:51057778-51057800 GATGCTGGGGCTCCAGCCTTAGG + Intronic
1025233510 7:57218554-57218576 GCTGCTGTTGCTTAAGGCTGAGG + Intergenic
1026684232 7:72494610-72494632 GGTGCTGGGGCTACAGGCATGGG - Intergenic
1026734545 7:72941376-72941398 GCTGCTGGTGTTCCCGGCCCAGG + Intronic
1026765112 7:73155239-73155261 GCAGCCGGTGCTCCAGGATGTGG - Intergenic
1026784879 7:73296284-73296306 GCTGCTGGTGTTCCCGGCCCAGG + Intergenic
1026905463 7:74060474-74060496 GGTGCTGGTGTTCCTGGCTTCGG + Exonic
1027041585 7:74964994-74965016 GCAGCCGGTGCTCCAGGATGTGG - Exonic
1027082057 7:75237375-75237397 GCAGCCGGTGCTCCAGGATGTGG + Intergenic
1027109198 7:75423646-75423668 GCTGCTGGTGTTCCCGGCCCAGG - Intronic
1028923422 7:96331233-96331255 GCTGATGGGGCTCCAGGCTGAGG - Intergenic
1029390639 7:100271921-100271943 GCAGCCGGTGCTCCAGGATGTGG + Exonic
1030143323 7:106327581-106327603 GCTGATGGTGTTCCAGGCCCTGG + Intergenic
1031862281 7:126994312-126994334 GCTGTTGGTGATTCAGGGTTCGG - Intronic
1032950208 7:136900440-136900462 GATGCTGCTGCTCCAAGCTAAGG - Intronic
1034480521 7:151316982-151317004 TCTGCTGGTAATCCAGGCATCGG + Intergenic
1034977838 7:155458393-155458415 GCCGCTGCTTCGCCAGGCTTGGG - Exonic
1035016153 7:155768051-155768073 CCTGCTGGTCCTCCTGTCTTTGG + Intronic
1035423708 7:158752313-158752335 GCTTCTGGTGCTGCTGGGTTTGG - Intronic
1035448162 7:158957068-158957090 GCTGCTGCTGCTGCCGGCCTGGG + Intergenic
1035534129 8:378299-378321 GCTGCGTGTGCTCATGGCTTGGG + Intergenic
1037879621 8:22566350-22566372 GTAGCTGGAGCTCCAGGCTGAGG - Exonic
1037914019 8:22761116-22761138 GCTGGGGAGGCTCCAGGCTTTGG - Intronic
1040026586 8:42787062-42787084 GCTGCTCGTTCTGGAGGCTTGGG - Intronic
1040532644 8:48277754-48277776 GCTTCTAGTGCCCCAGGCCTTGG + Intergenic
1044568938 8:93696813-93696835 TCTTCTGGTTCTCCAGCCTTTGG + Intergenic
1045468134 8:102488003-102488025 GAGGCCAGTGCTCCAGGCTTGGG - Intergenic
1046102003 8:109625549-109625571 GCAGCTGGAACTACAGGCTTAGG + Intronic
1047557723 8:125950710-125950732 CCTGCTGGTGCTAGAGGCTTTGG + Intergenic
1049657864 8:143806687-143806709 GCTGCCTGTGCACCAGGCCTGGG - Intronic
1049770183 8:144376421-144376443 GCTGCTGGTGGACCAGGGTAGGG + Intronic
1049814190 8:144590552-144590574 GCTGGTGGTTCTGCAGGCTGTGG - Intronic
1051222867 9:14868917-14868939 GCTGCTGCTCCTCCTGGCCTGGG - Exonic
1051595474 9:18820719-18820741 GCTGTTGATGCTTCAGGATTGGG - Intronic
1051871617 9:21744465-21744487 GATGCTGATGCTGCTGGCTTGGG - Intergenic
1052179589 9:25507531-25507553 GCTGCTGGTTTTCCACGCTCTGG - Intergenic
1052820566 9:33135218-33135240 GCTGCTGGCGCTGCAGGACTGGG + Exonic
1053283074 9:36834157-36834179 GCTGCTGGGCCTCCAAGGTTGGG - Exonic
1057135835 9:92687197-92687219 GCAGCAGGTGCTCCAGGAGTAGG - Intergenic
1057327912 9:94082975-94082997 GATGCTGGTTCTCCAGGCCATGG + Intronic
1057440567 9:95080055-95080077 GCTGCTGGTGCTCCTTCCTCAGG - Intronic
1058726747 9:107811963-107811985 GATGCTGATGCTTCTGGCTTAGG - Intergenic
1059233592 9:112743417-112743439 GCTGCAGCAGCTCCAGGCATTGG + Intergenic
1059335983 9:113568766-113568788 GCTCCAGCTTCTCCAGGCTTAGG - Intronic
1060103766 9:120861142-120861164 GTGGTTGGTGCTCCAGGCTGAGG + Exonic
1060946317 9:127571176-127571198 GCTGTGGGTGTTCCAGGCTTGGG - Intronic
1060984663 9:127813235-127813257 GCTGCTGGTGTTCCAGGCAGCGG - Exonic
1061570455 9:131474888-131474910 GCTGCTGGAGCTCCGGGGCTCGG - Exonic
1061938238 9:133870596-133870618 GCTGCTGGTCCCCAAGGCTCAGG - Intronic
1061938691 9:133872560-133872582 CCTGCCTCTGCTCCAGGCTTTGG - Intronic
1062150864 9:135018425-135018447 GGTGATGGTGCACCTGGCTTGGG - Intergenic
1062282984 9:135760197-135760219 GCTGCTGCTGCACCTGGCTGTGG - Intronic
1062495593 9:136830124-136830146 GCTCCTGGTGCTCCGGGCACTGG - Intronic
1062636688 9:137495163-137495185 GCTGCTGGGGCCGCGGGCTTGGG + Intronic
1203433819 Un_GL000195v1:119375-119397 GTAGCTGGGGCTACAGGCTTGGG + Intergenic
1203516604 Un_GL000213v1:7354-7376 GCTTCTGGAGGTCCAGCCTTAGG - Intergenic
1185557326 X:1031722-1031744 GCTGCTGGTGGACCAGGCCCAGG - Intergenic
1186963408 X:14761618-14761640 TCTGCAGGTGCTCAAGGATTAGG - Intergenic
1187146544 X:16642592-16642614 GCAGCTGGTGTGTCAGGCTTGGG - Intronic
1188437117 X:30173687-30173709 GCTGCTGCTGCTGCTGGCCTGGG - Intergenic
1188916671 X:35919916-35919938 GCTGCGGGTGATCCCGGCTGAGG + Exonic
1189335496 X:40168560-40168582 GCTCCTGTTGCTCGAGGCCTCGG + Intronic
1189472241 X:41323082-41323104 GCTGCTGGCATTCCTGGCTTGGG + Intergenic
1189523631 X:41797215-41797237 GCTGCGGGTGGTTCAGGATTGGG - Intronic
1190285203 X:48957130-48957152 GCGGCTGCTGCTCCGGGCCTGGG - Exonic
1193250863 X:79289231-79289253 GCTGCTGCTGCTGCTGGCATGGG + Intergenic
1198178435 X:134180171-134180193 ACTGCTGGTGCCCCAAACTTTGG - Intergenic
1198225528 X:134641690-134641712 GCTGATGGTGTTCCATGATTTGG + Intronic
1201579574 Y:15496403-15496425 GCTGCTGCTTCACCAGGCTAGGG + Intergenic