ID: 1002434818

View in Genome Browser
Species Human (GRCh38)
Location 5:179224803-179224825
Sequence CTGAGGTGGCAGACAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002434818_1002434825 9 Left 1002434818 5:179224803-179224825 CCCAGGTCTGTCTGCCACCTCAG 0: 1
1: 0
2: 3
3: 35
4: 426
Right 1002434825 5:179224835-179224857 CAGACCAAAGCTGTGTCCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 267
1002434818_1002434828 26 Left 1002434818 5:179224803-179224825 CCCAGGTCTGTCTGCCACCTCAG 0: 1
1: 0
2: 3
3: 35
4: 426
Right 1002434828 5:179224852-179224874 CTCAGGTCTGTCTGCCACCTCGG 0: 1
1: 0
2: 3
3: 37
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002434818 Original CRISPR CTGAGGTGGCAGACAGACCT GGG (reversed) Intronic
900220244 1:1504749-1504771 CTGAGCTGGCACCCTGACCTTGG - Intergenic
900305375 1:2004052-2004074 TGGAGGTGACAGACAGACTTGGG + Intergenic
900589088 1:3451792-3451814 CTTTGGCGTCAGACAGACCTGGG + Intergenic
900638049 1:3675344-3675366 CTGAAGTGGCAAAGAAACCTGGG - Intronic
900655681 1:3755666-3755688 CTCAGGAGGCAGACAGTCCCGGG - Intronic
901440693 1:9276281-9276303 GTGAGAAGGCAGACAAACCTCGG - Intergenic
901765724 1:11498900-11498922 CTTTGGAGGCAGACAGACTTGGG - Intronic
901830472 1:11889005-11889027 CTGAGGGAGGAGCCAGACCTCGG - Intergenic
901973853 1:12929337-12929359 TTGAGGTGGTAGGCAGAGCTGGG + Intronic
902011325 1:13272431-13272453 TTGAGGTGGTAGGCAGAGCTGGG - Intergenic
902202875 1:14846911-14846933 CTGTGGTGTCAGCCAGACCCGGG - Intronic
902289551 1:15427375-15427397 CTGAGGCTGCAGACAGAGATGGG + Intronic
902713978 1:18259913-18259935 GTGTGGTGACAGACAAACCTGGG + Intronic
902839380 1:19065599-19065621 CTTTGGTGTCAGACAGTCCTGGG - Intergenic
903178953 1:21595970-21595992 CTGTGCTGTCAGGCAGACCTAGG - Intergenic
903383561 1:22912763-22912785 TGTAGGTGGCAGGCAGACCTGGG - Intronic
904033792 1:27548706-27548728 CTGACGTGGCAGTCAAAACTGGG + Exonic
904140023 1:28345717-28345739 CTGAGGTGGGAGAATCACCTGGG + Intergenic
904283609 1:29438869-29438891 CAGAGGAGTCAGAAAGACCTGGG - Intergenic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905370235 1:37479156-37479178 CTGAGGGGGCAGTGAGACGTGGG + Intronic
906279651 1:44544314-44544336 CTCTGGAGTCAGACAGACCTGGG + Intronic
906487764 1:46244876-46244898 CTGAGGTGGGAGACTGAGCCTGG + Intergenic
906780604 1:48569700-48569722 TGGAGGAGGCCGACAGACCTGGG + Intronic
906929678 1:50156764-50156786 CCCAGCTGGCAGACAGACATGGG - Intronic
907170940 1:52463995-52464017 CTCTGGAGTCAGACAGACCTGGG + Intronic
907340445 1:53731542-53731564 CTCTGCTGTCAGACAGACCTGGG + Intronic
907366286 1:53963424-53963446 CTGTGGAGTCAGAAAGACCTGGG + Intronic
907399017 1:54213100-54213122 CTGAGTTGGCAGGCAGGGCTTGG - Intronic
907570208 1:55476426-55476448 CTGAGGAGGCTTGCAGACCTGGG + Intergenic
908012915 1:59800370-59800392 CTGAGGTGGCAGGCGGGCTTGGG - Intergenic
909910926 1:81256908-81256930 CTGAGGTGGGAGAATGGCCTGGG - Intergenic
910106127 1:83633009-83633031 CTCAGGTGGCAGATTGACTTGGG + Intergenic
910516922 1:88072393-88072415 CTCTGGAGTCAGACAGACCTGGG + Intergenic
913534551 1:119758835-119758857 CTCAGGTGGCTGACATCCCTTGG + Intronic
915076394 1:153311453-153311475 CTCTGGAGTCAGACAGACCTGGG - Intergenic
915444691 1:155967923-155967945 CAGAGGGGGCAGACAGAAGTGGG + Intronic
915636262 1:157189287-157189309 CTGAGGTGGGAGAGTGGCCTGGG + Intergenic
915636275 1:157189343-157189365 CTGAGGTGGGAGAGTGGCCTGGG + Intergenic
915636292 1:157189399-157189421 CTGAGGTGGGAGAGAGGCCTGGG + Intergenic
915959663 1:160254855-160254877 CTTTGGTGTCAAACAGACCTGGG + Intronic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
918521213 1:185416848-185416870 CTCTGGAGCCAGACAGACCTTGG + Intergenic
918683384 1:187383528-187383550 CTGAGGTGGCCGCTTGACCTTGG - Intergenic
919468038 1:197945794-197945816 CTGAGGTGGCAGGCAGAGTGAGG + Intergenic
919983376 1:202656471-202656493 ATCAGGAGCCAGACAGACCTGGG + Intronic
920399640 1:205669014-205669036 CTGGGGTGGGAGCCAGCCCTGGG - Intronic
920554557 1:206895229-206895251 CTTTGGAGGCAGGCAGACCTGGG - Intergenic
922515747 1:226207069-226207091 CTGTGGTATCAGGCAGACCTGGG + Intergenic
924644859 1:245868268-245868290 CTTTGGAGCCAGACAGACCTGGG - Intronic
1063037375 10:2299799-2299821 CTAGGGTGGCAGACAGACACTGG + Intergenic
1063211501 10:3885053-3885075 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1063280597 10:4625399-4625421 CTGTAGTGGAAGCCAGACCTTGG - Intergenic
1065535503 10:26711442-26711464 CTAAAGTGGCAGCCAGACCTGGG - Intronic
1065978449 10:30865010-30865032 CTTTGGTGCCAGACAGTCCTGGG - Intronic
1067756395 10:49008983-49009005 CTGATGAGGGAGACAGCCCTGGG + Intergenic
1068492309 10:57738812-57738834 CTGAGGTGGCTCAAATACCTTGG - Intergenic
1071765164 10:88655798-88655820 GTAAGGTGGGAGGCAGACCTAGG + Intergenic
1072255481 10:93616390-93616412 CTGTGGCATCAGACAGACCTGGG + Intronic
1072498513 10:95987861-95987883 CAGTGGAGGCAGACAGTCCTAGG - Intronic
1072764353 10:98083678-98083700 GTGAGGTGGCAGGCAGGCATGGG - Intergenic
1072893407 10:99345047-99345069 GTCAAGAGGCAGACAGACCTGGG + Intronic
1072919924 10:99568214-99568236 TTGGGGTGTCAGACTGACCTGGG + Intergenic
1074460500 10:113632531-113632553 CTTTGGTGTCAGAGAGACCTAGG - Intronic
1074767936 10:116714329-116714351 CTGAGGAGAGAGGCAGACCTGGG - Intronic
1076133261 10:128028277-128028299 CTGAGGTCGCAGAAAGGACTGGG - Intronic
1076251237 10:128985224-128985246 CAGAGGTGTCAGCCAGCCCTAGG + Intergenic
1076579723 10:131499261-131499283 CAGAGGTGGCAAACAGACAGGGG - Intergenic
1077493268 11:2871852-2871874 CTGAGGTGGCAGAGTGAACAGGG - Intergenic
1077671024 11:4157609-4157631 CTGATGTGGCAGAGGGTCCTGGG - Intergenic
1078455235 11:11469799-11469821 CTCAGGTGGCAGTTAGACATGGG + Intronic
1079056303 11:17208917-17208939 CTGATGTGGCAGACTGATTTAGG + Intronic
1079113207 11:17619170-17619192 CTGAGGTGGGAGAATCACCTGGG + Intronic
1079932325 11:26579799-26579821 TTGAGGAGTCAGACAAACCTGGG + Intronic
1080406213 11:31981740-31981762 CTGAGGAGTCAGGCAGACCTGGG - Intronic
1080409373 11:32009396-32009418 CTGCGGTGCCTGAGAGACCTGGG + Intronic
1080409679 11:32011850-32011872 CTGTGGAGCCAGACAGAGCTGGG - Intronic
1081713166 11:45231006-45231028 CTGAGCTGGCCACCAGACCTCGG + Intronic
1082047308 11:47740479-47740501 CTGTGATGGCAGAGAAACCTGGG - Intronic
1082809806 11:57472855-57472877 CTCTGGAGTCAGACAGACCTGGG - Intronic
1082834455 11:57641290-57641312 CTGAGGAGGCAGCCAGCGCTGGG - Intergenic
1083229904 11:61310189-61310211 CAGATGTGGCAGACTGTCCTAGG - Intronic
1083324976 11:61868713-61868735 CTCTGGGGTCAGACAGACCTAGG - Intergenic
1083364142 11:62131191-62131213 CTGAGTTGGCACTCAGACCCAGG - Intronic
1085333046 11:75668684-75668706 CTGCGGCGGCGCACAGACCTCGG + Exonic
1087183137 11:95158964-95158986 CTGTGGAGTCAGACACACCTAGG - Intergenic
1087955949 11:104288257-104288279 CTGGGGTGGAAGACAAACATTGG - Intergenic
1089358286 11:117870027-117870049 GTGAGGTGACAGCAAGACCTGGG - Intronic
1089387894 11:118079872-118079894 CTGAGGTGGTAAACTGAGCTGGG + Intronic
1089405571 11:118194670-118194692 CTGTGGAGTTAGACAGACCTGGG - Intronic
1089685591 11:120144700-120144722 CTGTGGGTGCAGCCAGACCTGGG + Intronic
1089731956 11:120524846-120524868 CTGTGGTGGCAGAGAGCCCCAGG + Intronic
1089792877 11:120957081-120957103 CTGAGCTGGCAGAAAGCACTCGG - Intronic
1091111478 11:132972918-132972940 TCCAGGTGCCAGACAGACCTAGG - Intronic
1092594940 12:9991944-9991966 CTGAGGAGACACAGAGACCTGGG - Intronic
1092948744 12:13480705-13480727 CTGAGGTTGCAATCAGACCTTGG - Intergenic
1093009736 12:14093883-14093905 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1094329555 12:29276035-29276057 CTTCAGAGGCAGACAGACCTGGG + Intronic
1095921226 12:47533104-47533126 CTGAGGTGTCAGGCATACTTGGG - Intergenic
1096227552 12:49876117-49876139 CTGGGGAGTCACACAGACCTGGG + Intronic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1096534673 12:52263739-52263761 ATGGGGAGGCAGACAGACCCAGG + Intronic
1096537481 12:52284597-52284619 CAGGGGTGGCTGAGAGACCTTGG + Intronic
1096806113 12:54142093-54142115 CTGAGGGAGCAGAGAGGCCTGGG - Intergenic
1097042111 12:56161970-56161992 CTGAGGTGACGGACAGGCTTAGG - Intronic
1097163226 12:57065618-57065640 CTGAGGTGGGAGAATCACCTGGG - Intronic
1098058747 12:66537706-66537728 CTTAGGTGGCAAACAGAACATGG + Intronic
1098535443 12:71589231-71589253 CTCAACTGCCAGACAGACCTGGG + Intergenic
1098891228 12:76012256-76012278 ATGAGGTTGCAGGCAGACCAAGG + Intergenic
1099987842 12:89688693-89688715 CTAAGGTGGGAGTCAGATCTGGG + Intronic
1100447267 12:94672744-94672766 CTGGGGTATCAGACAGACTTGGG - Intergenic
1100562190 12:95758661-95758683 CTGAGGTGGGAGGTACACCTGGG - Intronic
1101531192 12:105575000-105575022 CTGGGGTATAAGACAGACCTGGG + Intergenic
1101532179 12:105583414-105583436 CAGAGGAGTCAGGCAGACCTGGG - Intergenic
1101654706 12:106709683-106709705 CTTTGGTGTCAGACAGACCTGGG - Intronic
1101804285 12:108049985-108050007 CAGAGGAGACAGACAGAGCTGGG + Intergenic
1102318574 12:111911120-111911142 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1104643556 12:130482107-130482129 CTGAGGTGGCAGCCAGGGTTTGG - Intronic
1104970111 12:132527281-132527303 CAGAGGAGGCAGGAAGACCTGGG - Intronic
1105280872 13:18961916-18961938 CTGTGGGGGCAGCCAGACCTGGG - Intergenic
1105605401 13:21922655-21922677 CTGAAGTGACTGACACACCTGGG + Intergenic
1105983812 13:25545952-25545974 ATGAAGTGGCAGACAGATCATGG + Intronic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1106511786 13:30419377-30419399 CTGTGGTGGCAGACAGGCCTGGG + Intergenic
1107830057 13:44367128-44367150 CTGAAGTGGCAGACAGGACATGG - Intergenic
1108337339 13:49458517-49458539 CTGAGGTGGAAGAGAAACCCAGG - Intronic
1108341744 13:49504342-49504364 CTGAGGTGGGAGACTGAGGTGGG + Intronic
1110730135 13:78870796-78870818 GTGAGGTGGCTGAAAGACCAGGG + Intergenic
1111815480 13:93147659-93147681 TTTAGGAGGCAGACAGCCCTTGG - Intergenic
1112091071 13:96084883-96084905 CTGAGGTGGCAGACAGAAGTGGG + Intergenic
1113417127 13:110137064-110137086 CTGGGTTGGCTGACAGAGCTGGG + Intergenic
1114258924 14:21024122-21024144 ATGACATGGGAGACAGACCTGGG + Exonic
1114514931 14:23292790-23292812 CTGAGGTGGGAGACTCACTTGGG + Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1117278439 14:54213359-54213381 CTGAAGTGGCAGCCAGCCCATGG + Intergenic
1118693337 14:68360890-68360912 CTGAGGGGGTAGACAGAGCAAGG + Intronic
1119209595 14:72821188-72821210 CTGAGGTGGGAGGCAGAGCCTGG + Intronic
1119509397 14:75199042-75199064 CTGAGGCAGCAGCCAGAGCTTGG + Intergenic
1119605132 14:76009204-76009226 CTCAGGTATCAGACACACCTGGG + Intronic
1119653303 14:76398850-76398872 CTTAGGAGGCAGGCAGACCTAGG - Intronic
1120121941 14:80691437-80691459 CTGAAGTGAGAGAGAGACCTAGG + Intronic
1121819390 14:96954108-96954130 CTTAGGTGCCAATCAGACCTGGG - Intergenic
1123108146 14:105852511-105852533 CTGGGGTGGCAGAGAGAGCGTGG + Intergenic
1123887684 15:24743032-24743054 TTGAGGTGGAAGACAGAAATTGG - Intergenic
1124167474 15:27340785-27340807 CTGATGGGGCAGACAAACCCTGG + Intronic
1124354613 15:28985439-28985461 CTGAGGTGGCAGAAGCACTTAGG - Intronic
1125542002 15:40475021-40475043 TTTGGGAGGCAGACAGACCTGGG - Intergenic
1125590199 15:40849683-40849705 CTGTGGAGTCTGACAGACCTTGG + Intronic
1125734674 15:41916310-41916332 CTGAGGTGTCACACTGACCGAGG + Intronic
1126063006 15:44801959-44801981 CTGTTGTGGAAGACTGACCTGGG - Intergenic
1126416821 15:48426438-48426460 CTGAGGTGGATGACAGTGCTGGG + Intronic
1127834090 15:62776024-62776046 CCAAGGTGACAGACAAACCTGGG - Intronic
1128152304 15:65371023-65371045 TTGTGGTGGCAAACAGACCTGGG - Intronic
1128713349 15:69888605-69888627 CCGAGGTGGCAGCAAAACCTTGG - Intergenic
1128981382 15:72189834-72189856 CTAAGCTTTCAGACAGACCTGGG - Intronic
1131157622 15:90084784-90084806 CTGGGGTGGTAGGCAGACCCTGG - Intronic
1131655722 15:94456505-94456527 CTTATGTGGCAGACAGAGCTGGG + Intronic
1132464170 16:70103-70125 CTGACATGGCAGACACACCCAGG + Intronic
1132543733 16:523541-523563 CTGAGGGGACTGGCAGACCTGGG - Intergenic
1132715768 16:1289171-1289193 GGGAGGAGGCAGAGAGACCTGGG - Intergenic
1133738030 16:8630446-8630468 CTGTGGCGTCAGACAGACCTAGG - Intronic
1133987393 16:10678846-10678868 CTGAGGAGGCAGACTGTCTTTGG - Intronic
1134052779 16:11148611-11148633 CTTTGGTGGCAGACAGACATGGG - Intronic
1134293557 16:12923909-12923931 CTGTGGAGTCGGACAGACCTGGG - Intronic
1135172387 16:20197259-20197281 CGCTGGAGGCAGACAGACCTGGG + Intergenic
1135595024 16:23735206-23735228 CTGGTGTGGCAGAAAGATCTGGG + Intergenic
1135868768 16:26129385-26129407 CTATGGTGTCAGACAGACTTGGG + Intronic
1136899094 16:34015883-34015905 CTGAGTTGGGAGTCAGACCTGGG + Intergenic
1137289225 16:47040394-47040416 CTCTGGAGGCAGAGAGACCTGGG - Intergenic
1137388435 16:48061104-48061126 CTGAGGTGGGAGGAATACCTGGG + Intergenic
1137444169 16:48521920-48521942 CTAAGGTGGGAGACTCACCTAGG + Intergenic
1138426397 16:56935471-56935493 ATGAAGAGGCAGACACACCTTGG - Exonic
1138599871 16:58047917-58047939 CTCAGGTAGGAGGCAGACCTGGG - Intergenic
1139171726 16:64638374-64638396 CTCAGGTAGCAGACAGATCCAGG + Intergenic
1140169872 16:72593504-72593526 CTGAGGTTTCAGACCGGCCTGGG + Intergenic
1141889119 16:86914890-86914912 CTGAGGTGGCAGATAGTACCGGG - Intergenic
1141986781 16:87585422-87585444 CTTGGGAGTCAGACAGACCTGGG - Intergenic
1142243951 16:88960150-88960172 CTGGGAGGGCAGACAAACCTGGG - Intronic
1142494154 17:297437-297459 CTGAGGCGGGGGACAGTCCTGGG + Intronic
1142685458 17:1574896-1574918 TTCAGGTGGCAGACAGAACGAGG + Exonic
1144051227 17:11498737-11498759 CTGTGGAGCCAGAAAGACCTGGG + Intronic
1144425298 17:15135629-15135651 CTTAGATGGCAGTGAGACCTGGG - Intergenic
1144696096 17:17304753-17304775 CTTGGGAGGCAGACAGACTTGGG - Intronic
1146012137 17:29204661-29204683 CTGAGGTGGCAGACTGAGGTAGG - Intergenic
1146012293 17:29205641-29205663 CTTTGGAGCCAGACAGACCTGGG + Intergenic
1146380542 17:32324012-32324034 CTGAGGTGGCTGCCAGCCCAGGG + Exonic
1146923579 17:36729392-36729414 CAAAGGGGGCAGGCAGACCTGGG + Intergenic
1147627452 17:41909282-41909304 CAGAGGTGTCAGACAGACAGGGG + Intronic
1147632278 17:41939816-41939838 CTGTGGAGTCAGGCAGACCTAGG + Intronic
1148027836 17:44600636-44600658 CTTGGATGGCAGACAGACCCGGG + Intergenic
1148043923 17:44730739-44730761 CTGAGGTGGCAGCCTGAACCTGG - Intronic
1148141753 17:45333943-45333965 CTGAGGTTGCAGACAAATCCAGG + Intergenic
1148386870 17:47240326-47240348 CTGAGGAGGCACCCAGAGCTGGG - Intergenic
1148542649 17:48492698-48492720 CTGACGTGGGAGCCAGGCCTGGG + Intergenic
1148597658 17:48869683-48869705 CAGAGATGGCAGACAGACACGGG + Intergenic
1148606119 17:48930412-48930434 CGGAGGTGGCAAATAAACCTGGG - Exonic
1148914599 17:50964849-50964871 CTGAGGTGGGAGGATGACCTGGG - Exonic
1149515452 17:57277604-57277626 CTTAGGAGGCAGACAGTCTTAGG + Intronic
1150207161 17:63417771-63417793 AGGGGGTGTCAGACAGACCTGGG - Intronic
1150210603 17:63439187-63439209 CCGATGTGGCAGAGAGAACTGGG - Intronic
1150769821 17:68031515-68031537 CTGAGCTGGCTGAAAGACATAGG - Intergenic
1151305567 17:73260910-73260932 GTGAGTTAGCAGACAGGCCTGGG - Intronic
1151363014 17:73599891-73599913 CTGTGTTGGCAGACAGGACTTGG - Intronic
1151601536 17:75109311-75109333 CAGAGGTGGCGGACCCACCTCGG + Intergenic
1151767996 17:76141834-76141856 CAGAGGCGGCAGACACACCAAGG + Intergenic
1151994670 17:77601081-77601103 CTGAGGTGGCTCACTGAGCTGGG + Intergenic
1152262343 17:79273910-79273932 CGGAGGAGGCAGGGAGACCTGGG - Intronic
1152361152 17:79833774-79833796 CTGCGGCGGCTGTCAGACCTGGG - Exonic
1152556207 17:81054357-81054379 CTGAGCTGGCAGATGGACTTGGG + Intronic
1152677707 17:81650332-81650354 CTGAGTGGGAAGACAGCCCTTGG - Intergenic
1152941379 17:83174468-83174490 CAGTGGGGGCAGACAGACCTGGG - Intergenic
1153840769 18:9005857-9005879 CTGAGGTGGGACCCAGACCCAGG - Intergenic
1155391008 18:25336659-25336681 CTGTCGTGGCAGACTGAACTCGG + Intronic
1157035603 18:43969433-43969455 CTGAGGTGGGAGAATTACCTAGG - Intergenic
1157131490 18:45011763-45011785 CAGAGGTGGCATTCAGAACTAGG - Intronic
1157586383 18:48804014-48804036 CTGAAGAGGCACACAGGCCTGGG - Intronic
1157688030 18:49658693-49658715 ATGAGGTTGCAGACAGATGTTGG + Intergenic
1158371465 18:56810712-56810734 CTGAGGTGGCATGGATACCTTGG + Intronic
1161227267 19:3152523-3152545 CTTAGCTGGCAGACAGAGGTGGG + Intronic
1161269646 19:3382764-3382786 CTGAGGGGGGAGGCAGGCCTAGG + Intronic
1161316634 19:3620401-3620423 CTGGGCTGGTGGACAGACCTTGG + Intronic
1161869804 19:6861554-6861576 CTGGGGTTGCAGAGAGAGCTAGG - Intergenic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1163389589 19:17022223-17022245 CTGTGGTGGCAGCGAGACCAGGG - Intronic
1163626363 19:18392126-18392148 CTGGGGGGACAGACAGACCAGGG + Intronic
1164411166 19:28006778-28006800 CTGAGGTTGCAAAGAGACATAGG + Intergenic
1164690139 19:30204814-30204836 TGGAAGTGGCAGACACACCTGGG + Intergenic
1164873138 19:31663725-31663747 CTGAAGCATCAGACAGACCTGGG - Intergenic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166014532 19:39970336-39970358 CTTTGGGGACAGACAGACCTGGG + Intergenic
1166192252 19:41182835-41182857 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1166786773 19:45372012-45372034 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1167036045 19:46995536-46995558 CTAAGCTGGGAGACAGGCCTGGG + Intronic
1167482718 19:49742977-49742999 CTGAGGGGGAAGTGAGACCTTGG - Intronic
1167869447 19:52355602-52355624 CTGAGGTGGGCGACAGGCTTGGG - Intronic
1167916510 19:52744274-52744296 CTGAGGGGACAGAGAGTCCTAGG + Intergenic
1167932171 19:52874837-52874859 CTGAGGGGCCAGAGAGTCCTAGG + Intronic
1167945095 19:52981744-52981766 CTGAGGGGCCAGAGAGTCCTGGG + Intergenic
1168237984 19:55075742-55075764 CGGGGCTGGCAGACAGATCTAGG - Intronic
925755823 2:7131530-7131552 TTTAGGTGGGAGGCAGACCTGGG + Intergenic
925789310 2:7467759-7467781 CTGAGGTTGGAGACAGAGCATGG - Intergenic
925909565 2:8564708-8564730 CTGAGGCGACAGGGAGACCTGGG + Intergenic
926007552 2:9384476-9384498 CTGGGGTGGAAGACAGTCTTGGG - Intronic
927864330 2:26579070-26579092 CACAGATGTCAGACAGACCTGGG - Intronic
929033971 2:37672875-37672897 CTAAGGTTTCAGACAGACCCAGG - Intronic
929732828 2:44514001-44514023 CTGAGGTGGGAGAATCACCTGGG + Intronic
929764999 2:44837054-44837076 CTGAGGTGCCAGTGAGGCCTGGG + Intergenic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
929801808 2:45110834-45110856 CTTAGGAGTCAGACAGACTTGGG + Intergenic
931508069 2:62954164-62954186 ATGTGGAGTCAGACAGACCTGGG - Intronic
931674091 2:64676425-64676447 CTGTGGAGTCAGACAGTCCTGGG + Intronic
931801754 2:65765528-65765550 CTGAGGAGCCAGAGAGAGCTGGG - Intergenic
934620123 2:95798593-95798615 CTGGGGCGGCAGACAGACCCTGG + Intergenic
934640765 2:96025964-96025986 CTGGGGCGGCAGACAGACCCTGG - Exonic
934652290 2:96099524-96099546 CTCTGGAGGCAGATAGACCTGGG + Intergenic
934957730 2:98637674-98637696 CTTAGGAGTCAGAAAGACCTGGG + Intronic
937867822 2:126767213-126767235 CTGGGGTGGGGCACAGACCTAGG - Intergenic
938261112 2:129895692-129895714 CTTTGGTGCCAGACAGAGCTGGG + Intergenic
938982479 2:136539772-136539794 CTCTGGAGGCAGACAGGCCTGGG - Intergenic
941632761 2:167902970-167902992 CTGAGGTGGGAGAATCACCTGGG + Intergenic
941834284 2:169998835-169998857 CTGTGGAGTCAGACAGACTTGGG + Intronic
943067510 2:183104755-183104777 CTGAGCTGGCAGCCAAACCATGG + Intergenic
944838530 2:203603286-203603308 CTGATGTGGCAGAGAGAGATAGG + Intergenic
948769314 2:240240271-240240293 CTGAGGATGCAAACAGACTTAGG + Intergenic
1169149713 20:3279809-3279831 CTGTGGTGCCAAACAGACCTGGG - Intronic
1170204038 20:13778945-13778967 CTGAGGTGGGAGAATCACCTGGG + Intronic
1170482363 20:16779085-16779107 CTGAGGAAGCAGAGAGAACTAGG + Intergenic
1172593566 20:36134143-36134165 CTTTGGAGACAGACAGACCTGGG - Intronic
1172620049 20:36312814-36312836 CTGCGGGGGCAGACAGAGGTGGG + Intronic
1172854635 20:37992508-37992530 CTGAGGTGGGAGAATCACCTGGG - Intronic
1173323693 20:42013002-42013024 CTGTGGCTGAAGACAGACCTAGG + Intergenic
1173564529 20:44029415-44029437 CTTTGGGGTCAGACAGACCTGGG + Intronic
1173616441 20:44406287-44406309 CTCAGGGAGAAGACAGACCTTGG - Intronic
1174258487 20:49277215-49277237 CTGAGGTCGGAGGCAGAGCTGGG + Intronic
1174614998 20:51828818-51828840 CTGAGGTGGCAGGCAGGGCTAGG + Intergenic
1174711544 20:52711351-52711373 CTGAGGTGGCAGGCAAAGATGGG - Intergenic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175106331 20:56617660-56617682 CTGACCTGGCAGATGGACCTAGG + Intergenic
1176031349 20:63014526-63014548 CCGAGGGGGCAGACACAGCTAGG - Intergenic
1176222356 20:63975663-63975685 GTGAGGTGCCAGAGAGGCCTGGG - Intronic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1178582201 21:33846639-33846661 GTGCTGTGGCAGACAGTCCTGGG + Intronic
1179219071 21:39390387-39390409 CCCGGGTGGCAGACAGCCCTAGG - Intronic
1179636641 21:42715688-42715710 CTGAGGTGGAATATAGACTTTGG - Intronic
1181011750 22:20044879-20044901 CAGAGGCAGCTGACAGACCTGGG - Intronic
1181285737 22:21751033-21751055 CTGAGGTGGGAGCAACACCTAGG - Intergenic
1181872323 22:25909841-25909863 CTGGGGTGGCAGAAAGAGCTGGG + Intronic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182077743 22:27506424-27506446 TAGAGGAGCCAGACAGACCTGGG - Intergenic
1183236752 22:36624483-36624505 TTTTGGAGGCAGACAGACCTGGG - Intronic
1183527471 22:38332201-38332223 CTGAGGTGGGAGACTCGCCTGGG + Intronic
1183815800 22:40299180-40299202 CTGGGGAGGCAGGCAGAGCTGGG + Intronic
1184121645 22:42454453-42454475 CTGAGGTGGGAGGATGACCTGGG + Intergenic
1184274936 22:43404822-43404844 CTGAGGCGTCAGACAAGCCTGGG - Intergenic
1184393061 22:44216706-44216728 CTGGGCTGGGAGACAGAGCTAGG - Intronic
1184619622 22:45666381-45666403 CTCTGGAGTCAGACAGACCTGGG - Intergenic
1184657942 22:45951494-45951516 CTGGGGTGGCAGAAATATCTGGG - Intronic
1184714767 22:46274651-46274673 CTGAGGTGGAACCCACACCTGGG - Intronic
949416794 3:3823734-3823756 CTCAAGAGGCAGACAGAGCTGGG - Intronic
949461639 3:4301186-4301208 CTGAGCAGACAGACAGTCCTGGG + Intronic
949492454 3:4602427-4602449 CTGAGGTGGGAGAATGACCCGGG + Intronic
949849259 3:8405972-8405994 CTGAGGCCTCAGACAGACGTGGG + Intergenic
950206757 3:11086870-11086892 CTTTGGTGTCAGACAGACCTGGG - Intergenic
950486143 3:13275013-13275035 CCCTGGAGGCAGACAGACCTGGG + Intergenic
950638388 3:14332396-14332418 CTTAGGAGTAAGACAGACCTGGG - Intergenic
954795436 3:53159258-53159280 CTTTGGAGCCAGACAGACCTCGG + Intronic
955260984 3:57390202-57390224 CTGAGGTGGGAGACAAGCTTGGG + Intronic
955687019 3:61559208-61559230 CTGTGGAGGCAAACAGGCCTGGG + Intergenic
956963783 3:74434566-74434588 CTGTGGAGTCAGACAAACCTAGG + Intronic
958028688 3:88080585-88080607 CTTTGGAAGCAGACAGACCTAGG - Intronic
960890226 3:122440354-122440376 GTGAGGTGGCAGTCAGAGCAAGG + Intronic
960904273 3:122583922-122583944 TTGAGGAGACAGACAGACTTGGG - Intronic
960962609 3:123082900-123082922 CTCAGGAGTCAGACAGACCTGGG - Intronic
961007116 3:123412543-123412565 TTGCGGTGGCAGATAGAGCTCGG + Intronic
962929208 3:140021947-140021969 GTCAGGCGGCAGACAGAACTGGG + Intronic
964094657 3:152917324-152917346 CTGAGGTGGGAGAATTACCTGGG + Intergenic
964809378 3:160646947-160646969 CTCTGGAGTCAGACAGACCTGGG - Intergenic
967402399 3:189078368-189078390 CTGAGGTGGCAGACAAGCTGAGG - Intronic
967926354 3:194651883-194651905 CTGTGGAATCAGACAGACCTAGG - Intronic
968935524 4:3608153-3608175 CTGACCTGGCAGGCAGCCCTGGG + Intergenic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969307909 4:6336224-6336246 TTGAGGTCGCAGGCAGGCCTGGG - Intronic
969371175 4:6732592-6732614 CTCAGGATGCAGAGAGACCTGGG - Intergenic
969973255 4:11070210-11070232 GTCAGGAGGCAGAGAGACCTGGG + Intergenic
969998990 4:11344957-11344979 CTTAGGAAGCAGACTGACCTGGG - Intergenic
970244123 4:14040767-14040789 AGGAGGTAGGAGACAGACCTGGG + Intergenic
971172901 4:24251754-24251776 CTGTGGAGTCAGACAGGCCTGGG - Intergenic
971919852 4:32923731-32923753 CTGAGTTGACATACAAACCTTGG + Intergenic
972382375 4:38531327-38531349 CTGAGGAACCAGACAGAGCTGGG + Intergenic
975079961 4:70265280-70265302 CTGAGGTGGGAGAATCACCTGGG + Intergenic
979518233 4:121635885-121635907 CATAGGTGTAAGACAGACCTTGG + Intergenic
980126724 4:128781512-128781534 CTGAGGTGGGAGAATCACCTGGG + Intergenic
982660589 4:158201766-158201788 ATCAGGTTGCAGTCAGACCTGGG - Intronic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
983593661 4:169441908-169441930 CTGTGGTGGCGGACAGAGGTGGG - Intronic
983976725 4:173943889-173943911 CTGAGGGGTCAGAAAGACCTGGG + Intergenic
986612960 5:9588433-9588455 CTGAAGGGGCAGAAAGAACTAGG - Intergenic
986706421 5:10457899-10457921 CGGAGGTGGCTGACATCCCTGGG - Intronic
987224126 5:15821972-15821994 CTGAGGCAGCAAACAGAGCTTGG - Intronic
987342696 5:16952635-16952657 CTTCGGTGTCAGACAGAACTGGG + Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
991733070 5:69607646-69607668 CTGGGGTGGGAGACAGACCAGGG + Intergenic
991809506 5:70462791-70462813 CTGGGGTGGGAGACAGACCAGGG + Intergenic
991861883 5:71020205-71020227 CTGGGGTGGGAGACAGACCAGGG - Intronic
992784926 5:80160391-80160413 CAAAGTTGGCAGTCAGACCTAGG - Intronic
992968011 5:82022843-82022865 CTTTGGAGGCAGACACACCTTGG - Intronic
994554291 5:101278266-101278288 CTGAGGTGGGAGGATGACCTGGG + Intergenic
995813891 5:116144492-116144514 CTATGGAGTCAGACAGACCTGGG - Intronic
997597668 5:135117858-135117880 CTAAGGTGGGAGGCAGAGCTGGG + Intronic
997882216 5:137601381-137601403 CTCAGAAGTCAGACAGACCTGGG - Intergenic
998230224 5:140357106-140357128 CAGAGGTGGAAGTGAGACCTGGG + Intergenic
998406830 5:141878760-141878782 CCCAGGGGGCAGACAGAGCTGGG - Intronic
999114193 5:149148264-149148286 GTGAGGTGGTGGGCAGACCTAGG + Intronic
999366695 5:151028092-151028114 ATGAGGCGGCAGGCAGCCCTGGG + Exonic
999377495 5:151096991-151097013 CTGTGGAGGCAGGCAGGCCTGGG - Intergenic
999480150 5:151940820-151940842 CTGAGGAGGCAGAAAGTCCAGGG - Intergenic
999651362 5:153770584-153770606 CTGAGGTTGGAAACTGACCTGGG + Intronic
1000022027 5:157326534-157326556 CAGAGTTGGCAGGCAGAGCTTGG - Intronic
1000109404 5:158093612-158093634 CTGAGGTGGGAGAATTACCTGGG - Intergenic
1000872259 5:166591643-166591665 CAGAGCTGGGAAACAGACCTAGG - Intergenic
1000884610 5:166736815-166736837 TTGAGGTGTCAGACTGGCCTGGG + Intergenic
1001931313 5:175675030-175675052 CTCTGGAGGCTGACAGACCTCGG + Intronic
1002172167 5:177381404-177381426 CCCAGGTGGCTGACAGCCCTTGG + Intronic
1002344149 5:178536241-178536263 GTGAGGAGGCAGGCAGACCGGGG - Intronic
1002434818 5:179224803-179224825 CTGAGGTGGCAGACAGACCTGGG - Intronic
1004902879 6:20210279-20210301 CTTAGATGTCAGACTGACCTGGG - Intronic
1006131240 6:31870709-31870731 AGGACGGGGCAGACAGACCTAGG + Intronic
1006153384 6:32001235-32001257 GTGAGGGGGCAGAGAGCCCTGGG + Intronic
1006159692 6:32033972-32033994 GTGAGGGGGCAGAGAGCCCTGGG + Intronic
1006238080 6:32653360-32653382 CTGAGGTGGGAGAATCACCTGGG - Intergenic
1006393915 6:33774661-33774683 CTGAGGTGGCCCACCCACCTTGG + Intronic
1007197763 6:40077453-40077475 CTGAGTAGGAAGAGAGACCTAGG - Intergenic
1007613123 6:43163238-43163260 CTGAGGTGACAGAAATGCCTGGG + Intergenic
1008949214 6:57136942-57136964 CTTTGGTATCAGACAGACCTGGG + Intronic
1010259180 6:73795729-73795751 CTGTGGAGGCAGTCACACCTGGG + Intronic
1011552685 6:88544432-88544454 ATGAGGTGGCAGCAAGGCCTGGG - Intergenic
1011671181 6:89684587-89684609 CTGAGGTGGGAGACAGGCCTGGG + Intronic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1012990964 6:105925273-105925295 CTGAGGTGGGAGAATCACCTGGG + Intergenic
1013179993 6:107709275-107709297 CTCTGGTGCCAGAGAGACCTAGG + Intronic
1013353537 6:109327461-109327483 ATGAGTTGCCAGACAGACTTCGG + Intergenic
1013679252 6:112504992-112505014 ATGAGTTGGCAGACAGATCCAGG + Intergenic
1013779857 6:113717477-113717499 CTGAGGTGGGAGAATCACCTGGG - Intergenic
1015729072 6:136329906-136329928 CTCTGGAGGCAGACAGACCTGGG + Intergenic
1016289058 6:142507382-142507404 CTGGGCAGGCAGTCAGACCTTGG - Intergenic
1016426337 6:143939591-143939613 CCCAGCTGCCAGACAGACCTGGG - Intergenic
1018172545 6:161153641-161153663 CTGAGGTCACACACAGCCCTGGG + Intronic
1019110889 6:169712826-169712848 GTGAGCTGGCAGCCAGACTTGGG - Intronic
1019719973 7:2563293-2563315 CTGAGGTGGGAGAATCACCTGGG - Intronic
1020358928 7:7306263-7306285 CAGAGATGGCATACAGTCCTGGG - Intergenic
1021800463 7:24300382-24300404 CTAAGATGTCAGAAAGACCTGGG + Intergenic
1022235728 7:28458636-28458658 CTGTGGTTTCAGACAGACCTGGG + Intronic
1022248361 7:28583097-28583119 CTGTGGTTGAAGACATACCTGGG - Intronic
1022525624 7:31035208-31035230 CTGAGGTTGCAGCCAGCCCTGGG + Intergenic
1022819200 7:33942444-33942466 CAGAGATGGGAGACAGACCCAGG + Intronic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023813144 7:43927690-43927712 CTTGGGTGTCAGACAGACCTGGG + Intronic
1024281424 7:47722517-47722539 CTGAGGAGCCAGACACATCTGGG + Intronic
1025813749 7:64891091-64891113 GTGAGGTTGCAGCCAGGCCTGGG + Intronic
1026914582 7:74112161-74112183 GTCAGGAGGCAGACAGACCTGGG + Intronic
1028749829 7:94371109-94371131 CTCAGGAGGCAGAATGACCTAGG + Intergenic
1030051161 7:105538844-105538866 CTGAGGTGGCAGAGAGAACCTGG - Intronic
1030323342 7:108193119-108193141 CTGAGGTGGGAGAATTACCTGGG - Intronic
1031023007 7:116648911-116648933 CTGAGAAGGCAGACAGCTCTGGG - Intergenic
1031281753 7:119811717-119811739 CTGAGGTGCCAGAGAGACATGGG + Intergenic
1031927789 7:127654418-127654440 GTGCCGTGGCAGACAGGCCTGGG - Intronic
1031971729 7:128069489-128069511 ATGAGGTGGCAGAAAGAGCATGG - Intronic
1032551953 7:132792387-132792409 CCAAGGTGGCAGAAAGAACTGGG - Intronic
1033200318 7:139362739-139362761 CTGAAGTGGCACAGAGTCCTGGG + Intronic
1035663119 8:1362194-1362216 CCGAGGTGGCAGCGAGTCCTCGG + Intergenic
1036025190 8:4899855-4899877 CTCTGGTGTCAGACATACCTGGG + Intronic
1036721275 8:11177708-11177730 CTGGGGTGGCAGTCAACCCTTGG - Intronic
1038184537 8:25261010-25261032 CTGAGGTGGGAGACCAGCCTGGG - Intronic
1039438539 8:37578468-37578490 GAGAGGGGGTAGACAGACCTTGG - Intergenic
1039829758 8:41203784-41203806 CTGAGATGCCAGAGAAACCTGGG - Intergenic
1041175584 8:55193348-55193370 GTGGGGTGGCGGAGAGACCTGGG - Intronic
1044071024 8:87759891-87759913 CTGAGCTGGGAGAAAGAGCTGGG - Intergenic
1045458132 8:102402115-102402137 CTGAGGTGGGAGAACTACCTGGG + Intronic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1046952721 8:120033476-120033498 CTCTGGAGCCAGACAGACCTGGG - Intronic
1047752370 8:127891472-127891494 ATGTGGAGGCAGACAGGCCTGGG + Intergenic
1047935750 8:129776657-129776679 ATGTGGAGCCAGACAGACCTGGG + Intronic
1048579464 8:135719263-135719285 CTCAGGTGCCACTCAGACCTAGG - Intergenic
1049001583 8:139828738-139828760 CTCTGGAGCCAGACAGACCTGGG - Intronic
1049128122 8:140810694-140810716 CTGAGGTGGCTGTCAGGCATGGG - Intronic
1049252154 8:141595046-141595068 CTGTGGAGGAAGACAGCCCTTGG + Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1049711108 8:144063743-144063765 CTGAGGTGGCTGCCAGTCCCTGG - Intronic
1051710799 9:19928411-19928433 CTCTGGAGGCAGGCAGACCTGGG + Intergenic
1053017020 9:34667667-34667689 CAGAGGGGGCAGACAGGACTGGG + Intergenic
1053167672 9:35856018-35856040 CTGAAGTGGGAGACGGAGCTGGG + Intergenic
1053299840 9:36941147-36941169 CTCAGGAAGCAGACAGAGCTGGG + Intronic
1053865722 9:42435656-42435678 CTGAGATGGTAGACAGCCTTTGG - Intergenic
1054454660 9:65423704-65423726 CTGACCTGGCAGGCAGCCCTGGG - Intergenic
1055104944 9:72502460-72502482 CTGTGGAGTCAGACAGATCTAGG - Intergenic
1057370938 9:94472402-94472424 CTGAGGGGCCAGACAGAACAGGG - Intergenic
1058941724 9:109819424-109819446 CTTATGTGGCAGGGAGACCTGGG + Intronic
1059339107 9:113587394-113587416 CTGTGGAGTCAGACAGACCCAGG + Intronic
1059342142 9:113603268-113603290 CTTTGGAGGCTGACAGACCTGGG + Intergenic
1059382374 9:113936192-113936214 CTCCAGAGGCAGACAGACCTGGG + Intronic
1059508922 9:114825786-114825808 CTATGGAGGCAGAGAGACCTGGG + Intergenic
1059727874 9:117027267-117027289 CTGTGGAGTCAGACATACCTAGG - Intronic
1060368648 9:123046464-123046486 CTTGAGAGGCAGACAGACCTGGG + Intronic
1060788053 9:126465917-126465939 CTTTGGTGTCAGACAGCCCTAGG - Intronic
1061344119 9:130008248-130008270 CTGAGGTGGGAGGATGACCTGGG + Intronic
1061616930 9:131786562-131786584 CTGAGGTGGGAGGAACACCTGGG - Intergenic
1061757793 9:132827473-132827495 CTGTGGTGGCAGATAGAGCTGGG - Intronic
1062190462 9:135245388-135245410 CGGAGGGGGCAGACTGAGCTGGG - Intergenic
1203613433 Un_KI270749v1:28922-28944 CTGAGATGAGAGTCAGACCTGGG + Intergenic
1185571800 X:1140338-1140360 CTGAGCTCGCAGACACACCATGG + Intergenic
1185633664 X:1535954-1535976 CTGAGGTGGCCGTGAGACCCGGG + Intronic
1185642740 X:1597529-1597551 CTGGGGTGGGAGACAGTCCTGGG + Intronic
1186493607 X:9994295-9994317 GTGCAGTGGCAGACAGATCTCGG + Intergenic
1187944370 X:24412032-24412054 CTGGGGTCGCAGCCAGCCCTAGG - Intergenic
1189385629 X:40534663-40534685 CTGAGGTGGCAGACCAGCCTGGG - Intergenic
1189564791 X:42230570-42230592 CTTTGGCGTCAGACAGACCTGGG + Intergenic
1193610923 X:83630924-83630946 CAGAGAAGGCATACAGACCTGGG - Intergenic
1194799005 X:98248143-98248165 CTGCGTTGGCAGAATGACCTAGG - Intergenic
1195260338 X:103125462-103125484 TTAAGGTGGCAGACAGACAGAGG + Intergenic
1196187956 X:112764588-112764610 CTGAGGTGGGATAGAGTCCTTGG - Intergenic
1196820081 X:119694422-119694444 CTGGTGTGGGAGAGAGACCTGGG + Intergenic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1198427404 X:136533652-136533674 CTGAGGGAGCAGACAGAGTTGGG + Intronic
1199447262 X:147939797-147939819 CTGAGGTGGGAGGAACACCTAGG + Intronic
1200081346 X:153578328-153578350 CTGAGCTGCCAGGCAGACCCTGG - Intronic