ID: 1002435604

View in Genome Browser
Species Human (GRCh38)
Location 5:179229069-179229091
Sequence CTGAGGGTCTGACGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002435604_1002435611 22 Left 1002435604 5:179229069-179229091 CCCTCTCTCCGTCAGACCCTCAG 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1002435611 5:179229114-179229136 TAAGACACATAGAAAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002435604 Original CRISPR CTGAGGGTCTGACGGAGAGA GGG (reversed) Intronic
900330706 1:2133211-2133233 CTGAGGGACTGACGCACAGCTGG - Intronic
900993515 1:6108518-6108540 ATGAAGGGATGACGGAGAGATGG + Intronic
901811160 1:11767351-11767373 ATGAGGGCCTGATGGAGAGGAGG + Intronic
902783817 1:18720558-18720580 ATGAGGTGCTGATGGAGAGAAGG + Intronic
904347904 1:29885275-29885297 GTGAGGGTTGGACAGAGAGATGG - Intergenic
906606488 1:47175993-47176015 CTCAGGGACTGAGGGAGAGGGGG + Intergenic
906659647 1:47573329-47573351 CTGAGACTCTGAGGGAGGGAGGG - Intergenic
909548912 1:76876884-76876906 CTGCTGGGCTGAGGGAGAGAAGG + Intronic
911591737 1:99755431-99755453 GGGAGGGACAGACGGAGAGAGGG + Intronic
911739326 1:101369835-101369857 CTTAAGTTCTGAGGGAGAGAAGG + Intergenic
912179710 1:107204998-107205020 CTGAGGCTCTGGCAGAGGGAAGG - Intronic
912556665 1:110521053-110521075 ATGAGGGTCTGATGGTGAGGAGG + Intergenic
913487844 1:119350005-119350027 CTGAGGGTATGATTGAGAGGCGG - Intergenic
915463648 1:156083277-156083299 CTGGGGGTCGGACGGAGAGTGGG + Intronic
915672742 1:157504052-157504074 CCGGGGATGTGACGGAGAGAAGG - Intergenic
915768460 1:158391984-158392006 CTGTGGTTCTAATGGAGAGATGG + Intergenic
918042007 1:180919236-180919258 CTAAGGGCCTGATGGAGAGGGGG + Intronic
919666750 1:200300051-200300073 CTGAGGGTTTTAGGGAGACAGGG - Intergenic
923712515 1:236398466-236398488 CTGAGGATCTGTCGGAGTGTTGG - Intronic
1063725507 10:8633125-8633147 CTGAGGCTGTGACACAGAGAAGG + Intergenic
1065861454 10:29875859-29875881 TCGGGGGTCTGAAGGAGAGAAGG - Intergenic
1066661323 10:37740190-37740212 CAGGGGGTCTGACCGAGGGAGGG + Intergenic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1069558856 10:69415722-69415744 CTGAGGGTTAGACACAGAGAAGG - Intronic
1070618423 10:77987513-77987535 CTGAGGGTCCCCCAGAGAGAAGG + Intronic
1071508524 10:86247095-86247117 CTGATGGTCAGAAGGACAGATGG + Intronic
1073443045 10:103564178-103564200 CTGAGGGTCACCCGGAGAGCTGG + Intronic
1075987029 10:126797083-126797105 CTGAGGGCATGAGGGAGAGGAGG + Intergenic
1076672357 10:132130304-132130326 CAGAGGGTCTTAATGAGAGAAGG - Intronic
1077178008 11:1199317-1199339 CAGAGGGACAGACGGAGGGAGGG + Intronic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1079115928 11:17640647-17640669 GGGAGGGACTGACGTAGAGAGGG + Intronic
1080534507 11:33208325-33208347 CTGATGGTCTGACGGTAAGATGG - Intergenic
1081561881 11:44225270-44225292 GTGAGGCTCTGAGGCAGAGAAGG - Intronic
1081960613 11:47133987-47134009 CTCAGGGTGGGAGGGAGAGAAGG - Intronic
1082854183 11:57791679-57791701 CTGCACGTCTGATGGAGAGAGGG - Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1084455772 11:69267451-69267473 CAGAGGGACGGAGGGAGAGAGGG + Intergenic
1084515632 11:69636881-69636903 CTCAGGGTCTGAGGGACTGATGG - Intergenic
1085509919 11:77083041-77083063 TTGGAGGTCTGAGGGAGAGAGGG - Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1087051471 11:93890079-93890101 GAGAGGGTCTGAATGAGAGAGGG - Intergenic
1088074681 11:105832330-105832352 CTGAGGGTCTCCCAGAGACAAGG + Intronic
1088859922 11:113790085-113790107 CTGAGGGCGGGAAGGAGAGAAGG - Intergenic
1089259607 11:117214968-117214990 CTGAGGGTAGGAGGGAGAGTGGG - Intronic
1089390772 11:118100124-118100146 CTGAGGGTATGAGGCAGTGAAGG - Intronic
1094751301 12:33412616-33412638 CTAAGGGTCTGACTGTTAGAAGG + Intronic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1096137657 12:49216052-49216074 CTGAAAGTCAGAGGGAGAGAGGG + Intronic
1097125813 12:56774025-56774047 CTGCGTGTCTGACGGAGAAGGGG + Exonic
1098094874 12:66944606-66944628 CTGAGGAGCTGATGGAAAGAGGG + Intergenic
1101490907 12:105208443-105208465 CTGAGGGTCTGTGAGGGAGAGGG + Intronic
1102299043 12:111758029-111758051 CAGAGGATCTGAGGGAGATATGG - Intronic
1102736307 12:115163667-115163689 CTGAGGGTCTGAGAGAGCAAGGG - Intergenic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1104175295 12:126325893-126325915 CTGAGGGACTGACTGTTAGAAGG - Intergenic
1106112764 13:26791655-26791677 CTGAGGGCCTGCTGGAGAGCAGG - Intergenic
1106480327 13:30132951-30132973 CTGAGGGTTGGACGTAGAGCCGG + Intergenic
1106925405 13:34607895-34607917 CTGATGGTGGGAAGGAGAGAAGG - Intergenic
1108268869 13:48738997-48739019 ATGTGGGCCTGAGGGAGAGAGGG - Intergenic
1108979870 13:56497407-56497429 CTGAGGGTCTGATGTAAAGCAGG - Intergenic
1111732859 13:92099042-92099064 CGCAGGGTCTAACAGAGAGAAGG - Intronic
1111765090 13:92517612-92517634 CTGAGGGTCTGACTGTTAGAAGG + Intronic
1112443650 13:99444219-99444241 ATGAGGGTCTTCCAGAGAGAAGG - Intergenic
1113031120 13:105994651-105994673 CTGAGGGTGTGACAGAGGGTGGG + Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1114542275 14:23469936-23469958 CTGGGTGTCTGACGGAGAGAGGG + Intronic
1114674865 14:24432970-24432992 GTGAGGGTGTGAGGGAGAGCAGG - Exonic
1115059069 14:29168630-29168652 CTGAGGAGCTCAGGGAGAGAGGG + Intergenic
1116165479 14:41329607-41329629 CTGGGGGTCTGACTGTTAGAAGG - Intergenic
1118591199 14:67402560-67402582 GTGAGGGGCTGCCGGGGAGATGG - Intronic
1118812526 14:69285757-69285779 CTGAGGGACAGATGGAGAGGGGG - Intronic
1122134408 14:99624601-99624623 CTGAGGATCTGAGGCAGAGCAGG + Intergenic
1124116890 15:26852245-26852267 CTGAGGGTATGAGCGAGTGAGGG + Intronic
1124435598 15:29646456-29646478 CAGAGGGCCTCACGTAGAGAAGG - Intergenic
1125211838 15:37225819-37225841 GTGAGGGTGAGATGGAGAGAAGG + Intergenic
1125731649 15:41895569-41895591 CTGAGGGTCTTACTAGGAGAAGG - Intergenic
1126034902 15:44536967-44536989 CTGCGGGGCTGAGGGAGAGGCGG - Intergenic
1128081682 15:64860842-64860864 CTGAGGGACAGAGGGACAGAGGG + Intronic
1128326970 15:66730044-66730066 AAGAGGGTCTGACGGAGGGCTGG - Intronic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128940275 15:71782272-71782294 CTGAGGGTGTGACCGCAAGAGGG + Exonic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1131024780 15:89130998-89131020 CAGAGGCACTGAAGGAGAGATGG - Intronic
1131347806 15:91667089-91667111 CTGAGGGCCTGTCTGTGAGATGG + Intergenic
1132331341 15:101014301-101014323 ATGAGGGCCTGAGAGAGAGAGGG - Exonic
1133258451 16:4533306-4533328 CTATGGGTCTGACTGGGAGATGG - Intronic
1135120054 16:19758229-19758251 CTGAGGAGCTGAAAGAGAGAAGG - Intronic
1135922434 16:26663315-26663337 CTGAGTCTCTGAAGGAGAGCAGG + Intergenic
1135930032 16:26728476-26728498 CTGAGGGTCTGACCGGATGATGG - Intergenic
1136102207 16:28004397-28004419 CTGAGGGCCAGAAGGAGAGAAGG + Intronic
1136229035 16:28876366-28876388 GAGAGGGGCAGACGGAGAGATGG - Intergenic
1138007238 16:53349617-53349639 CTGAGGGCCTGACTGTTAGAAGG - Intergenic
1138536730 16:57664164-57664186 CTGGGGGGCTGAGGGAGGGAGGG - Exonic
1139650872 16:68361462-68361484 CTAAGGGTCTGAGGGAGTGATGG + Intronic
1140034362 16:71361181-71361203 CTGAGGCTGTGATGTAGAGATGG - Intronic
1141027148 16:80559372-80559394 CTAAGGCTCTAACGGAAAGAAGG + Intergenic
1142066217 16:88064549-88064571 CTGAGGGTTTGCCGAGGAGAGGG + Intronic
1142172596 16:88630702-88630724 CTGCTGGTCTGACGGGGTGAGGG + Intronic
1148644437 17:49211043-49211065 CTGAGGCTCTGAGAGACAGAAGG - Intronic
1148849788 17:50549028-50549050 CTGGTGGCCTGGCGGAGAGAGGG - Exonic
1150227900 17:63533742-63533764 CAGAGGGGATGAGGGAGAGATGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151164172 17:72189963-72189985 GTGAGAGTCAGAGGGAGAGATGG - Intergenic
1152486154 17:80594980-80595002 CTGAGAGTCAGAGAGAGAGAGGG + Intronic
1153477878 18:5517210-5517232 CTGAGAGTCTGACAGGGTGAGGG + Intronic
1156105850 18:33659525-33659547 CTGAGGAGGTGACAGAGAGACGG - Intronic
1157434635 18:47658091-47658113 CTGAGGGTGTCAAGGAGGGAGGG - Intergenic
1158157102 18:54438341-54438363 CAGAGGGTCTAAGGGAGAGATGG - Intergenic
1158819273 18:61140309-61140331 CTCAGGTTCTGATGGAGACAGGG - Intergenic
1160083557 18:75753680-75753702 CTGTGGGTCTGACTGAGTCAGGG + Intergenic
1160697819 19:493212-493234 CTGAGGGTCGCAAGGAGAGTGGG - Intronic
1162302164 19:9850161-9850183 CTGTGGGTCTGATGGAGAAGTGG + Intergenic
1162779345 19:12998556-12998578 CTGAGTCTCAGGCGGAGAGAGGG + Intronic
1163448452 19:17361427-17361449 CTGAGGCTGTGATGGAGACAGGG - Intronic
1163804438 19:19387027-19387049 CAGAGGGTCTCTCAGAGAGATGG - Intronic
1163982492 19:20914182-20914204 ATGAGGGGCTGACGGTGAAAAGG - Intergenic
1164578055 19:29417654-29417676 CAGAGGGTCAGACGAGGAGAAGG - Intergenic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1166083539 19:40459956-40459978 CTGAGGTTCTGAGGGGGACATGG + Intronic
927709099 2:25314203-25314225 CTGAGGGCCTGACCCAGGGAGGG - Intronic
928683806 2:33728003-33728025 CTGAGGAACTCACGGAGAAAAGG + Intergenic
929896933 2:45968865-45968887 CTCAGGGACTCAGGGAGAGATGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932665757 2:73697607-73697629 TTGAGAGTCTGACAAAGAGAGGG + Intergenic
933709235 2:85313689-85313711 CTGAGGGGGTGAGGTAGAGACGG + Intergenic
933856941 2:86423798-86423820 CTGAGGATCTGAGGAAGGGAGGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
936524874 2:113235575-113235597 GTGAGGATCTGCCGGAGGGAGGG + Exonic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
936775259 2:115965256-115965278 CTGAGGGACTGACTGTTAGAAGG - Intergenic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937309980 2:120896224-120896246 CTCAGGGTGGGGCGGAGAGAGGG - Intronic
939756611 2:146120491-146120513 CTGAGGGACTGCTGCAGAGAAGG + Intergenic
940095247 2:149966649-149966671 CTGAGGGCCTGACTGTTAGAAGG + Intergenic
942572795 2:177330405-177330427 CTGAGGGTCTGAGGGATGGTGGG + Intronic
942879199 2:180838874-180838896 CTGAGGGTCTGTCTGTTAGAAGG - Intergenic
945211410 2:207386921-207386943 CAGAGGGTCTCCCAGAGAGATGG + Intergenic
945711458 2:213301801-213301823 CTCAGGGTCTTACGGAGAAAGGG - Intronic
946394475 2:219436211-219436233 CTGAGGGTCTGAGGCAGAAGGGG + Intronic
948065506 2:235075687-235075709 CTGAGGGCCTGAGAGAGAGAGGG + Intergenic
1173061079 20:39661704-39661726 CTGAGGGTCTGAGAGAGCTAAGG + Intergenic
1173994110 20:47324647-47324669 CTGAGTGAATGAAGGAGAGAAGG - Intronic
1174081200 20:47971892-47971914 CAGAGGCACTGATGGAGAGAGGG - Intergenic
1174135301 20:48375000-48375022 CAGAGGCGCTGATGGAGAGAGGG + Intergenic
1174402396 20:50283038-50283060 GTGAGGGGCTGAGGGAGAAAAGG - Intergenic
1174514855 20:51083796-51083818 CGGAGGGTCAGAGGCAGAGAAGG + Intergenic
1175326302 20:58130786-58130808 CTGAGGGTCAGACGGATGAAAGG + Intergenic
1175461581 20:59155667-59155689 CTGAGTGTAGGAAGGAGAGAAGG + Intergenic
1175816497 20:61885805-61885827 CTGAGGATGAGACGGAGAGCAGG + Intronic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1176210019 20:63915058-63915080 CTGTGGGTCCCAGGGAGAGACGG + Intronic
1179100075 21:38348645-38348667 CTGACGGTTTGAAGGAAAGAGGG + Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1180151111 21:45948561-45948583 CTGAGGATCTGAGGGAGGGAGGG + Intergenic
1180535770 22:16391906-16391928 CTGCGGGTCTTAGGGAGAGATGG + Intergenic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1183471096 22:38007204-38007226 CTGGGGGCCTGCCGGAGACATGG - Intronic
1184061069 22:42081835-42081857 CTGAGGGTATGTCTGTGAGAGGG + Intronic
1184769669 22:46589861-46589883 CTGAGGGGCTGAGGGAGGGGAGG - Intronic
952963293 3:38606141-38606163 CTGAGGGTCTGGGGGAGCAAGGG + Exonic
957306723 3:78467279-78467301 CTGAGGGACTGACTGATAGAAGG - Intergenic
959822607 3:110754460-110754482 GTGGAGGTCTGAAGGAGAGAGGG + Intergenic
960003852 3:112761925-112761947 CTGAGGGTCAGAATCAGAGAAGG - Intronic
960426619 3:117515681-117515703 CTGAAGATCTGACGGAGATCTGG - Intergenic
960670586 3:120152085-120152107 CTGAGGGAAAGACAGAGAGATGG - Intergenic
960934604 3:122890378-122890400 ATGAGGGTGTGAGGGAGGGAGGG + Intergenic
962526450 3:136241937-136241959 CTGAGGGGCGGAAGTAGAGAAGG + Intergenic
965651439 3:170938143-170938165 CTGAGGGTCTGACTGTTAGAAGG - Intergenic
966140105 3:176747597-176747619 CAGAGCCTCTGAAGGAGAGATGG - Intergenic
967115329 3:186332438-186332460 CTGAGGGGCTGATGTAGGGAAGG + Intronic
967853383 3:194098577-194098599 CTAAGGAAATGACGGAGAGAGGG + Intergenic
968082571 3:195856877-195856899 CTGAGGTTCCAAGGGAGAGAGGG + Intergenic
968770416 4:2502261-2502283 CTCAGGGTCTGGCAGAGAGAAGG - Intronic
969845450 4:9916872-9916894 CTGAGTGTCTGGGGGAGAAAAGG - Intronic
971909365 4:32775708-32775730 CTGAGGCTCTGATGAAGACAAGG - Intergenic
973293392 4:48490909-48490931 CGGGGCGTCGGACGGAGAGAGGG + Exonic
976390343 4:84499106-84499128 CTGAGAGTGAGAGGGAGAGAGGG - Intergenic
977153585 4:93545086-93545108 CTCAGGGTCTGACAAGGAGAAGG - Intronic
977459802 4:97310784-97310806 CTGGAGGTGTGAGGGAGAGATGG - Intronic
981011977 4:139934534-139934556 CTGAGGGGGTGATGGAGAGAAGG - Intronic
982899949 4:160986085-160986107 CTGAGAGTCTGACTGGGGGAAGG - Intergenic
984369096 4:178838900-178838922 CAGAGAGTCTCAGGGAGAGAGGG + Intergenic
988495691 5:31743744-31743766 CTGAGAATCTGACAGAGAGTGGG - Intronic
992071852 5:73155765-73155787 CTGAGGCACTGAGGGAGGGAAGG - Intergenic
993453777 5:88104143-88104165 TTGAGGGTCAGAGGGAGAAAAGG + Intergenic
993498745 5:88639527-88639549 CTGAGGTCCTGGCTGAGAGAGGG + Intergenic
993626547 5:90231804-90231826 GGGAGGGACAGACGGAGAGAGGG + Intergenic
993626552 5:90231824-90231846 GGGAGGGACAGACGGAGAGAGGG + Intergenic
993881847 5:93372233-93372255 CTGAAGGCTTGATGGAGAGAAGG + Intergenic
993962654 5:94319185-94319207 GTGAGGCTCTCAGGGAGAGAGGG - Intronic
996532865 5:124544490-124544512 CTGAGGGGCTGAGGGTGAGTAGG - Intergenic
996875513 5:128236256-128236278 CTGAAGGGCTTACGGAGGGAGGG + Intergenic
997389002 5:133498030-133498052 CTGAGGGGCAGCTGGAGAGAGGG + Intronic
998476843 5:142429131-142429153 CAGAGGGTGTGACGCAGTGATGG + Intergenic
998951582 5:147397901-147397923 CTGAAGGTCTCAAGGAGAGAAGG - Intronic
1000688043 5:164277549-164277571 CAGAGGGACGGACAGAGAGACGG - Intergenic
1002209973 5:177592692-177592714 CTGAGAGGCTGGCGGAGAGGAGG - Intronic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003568952 6:7243409-7243431 CCGAGGGACTGATGGGGAGAGGG + Intronic
1004580222 6:16943535-16943557 CTGAGCCTCAGACGGAGAGTTGG + Intergenic
1006083709 6:31581772-31581794 CTGAGGGTCTGAAGCGGGGAAGG + Intronic
1006582184 6:35083541-35083563 CTGTGGGTCTGACGGGGATGTGG - Intronic
1006632778 6:35441407-35441429 CTGAGGGTCTGCCAGAGTGTGGG - Intergenic
1007818476 6:44541934-44541956 GTGAGGGTCACATGGAGAGAAGG + Intergenic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1010284919 6:74065685-74065707 CTAAGGGTGTGACAGAGAAATGG - Intergenic
1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG + Intergenic
1010800510 6:80168852-80168874 CTGAGGGTCAGAAAGAAAGACGG - Intronic
1010890244 6:81298948-81298970 CTAAGGGGATGAGGGAGAGAAGG + Intergenic
1013045531 6:106481539-106481561 CAGAGGGTCTCCAGGAGAGAAGG - Intergenic
1017544160 6:155433290-155433312 GTCAGGGCCTGAGGGAGAGATGG + Intronic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1019416714 7:931029-931051 CGGAGGGACTGAGGGAGGGAGGG + Intronic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020061654 7:5157012-5157034 CTGATGGTCTGATGGGTAGATGG - Intergenic
1020166504 7:5811649-5811671 CTGATGGTCTGATGGGTAGATGG + Intergenic
1022275662 7:28853702-28853724 CTGAACGTTTAACGGAGAGAAGG + Intergenic
1022369828 7:29759943-29759965 CTCAGGGTCTGAAGGGGATACGG + Intergenic
1023965537 7:44961627-44961649 CTGAGGGCCTGAGGGACTGAGGG + Intergenic
1024563704 7:50664632-50664654 CGGAGGGTCTGACGCAAAGGAGG + Intronic
1026114013 7:67481121-67481143 CTGAAGCTCTGATGGAGAGAAGG - Intergenic
1030100469 7:105941008-105941030 CTGAGGGTCTGTGGGAGACCTGG - Intronic
1032211621 7:129919790-129919812 CACAGGGTCTGACAGAAAGAAGG + Intronic
1032331325 7:130983216-130983238 CTGAGGGGCTGAAGGGGAGCTGG + Intergenic
1033012317 7:137635641-137635663 ATGAAGGCCTGACAGAGAGATGG + Intronic
1033172313 7:139095026-139095048 CAGAGGGGATGAAGGAGAGAAGG - Intronic
1033495437 7:141889199-141889221 CTGAGGGTGGAATGGAGAGAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034426778 7:151018201-151018223 CGGAGGGTCTGTCTGGGAGAGGG - Intronic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1034820202 7:154210202-154210224 CTGAGGGCCTGAAGGAGAGCAGG - Intronic
1035047202 7:155975502-155975524 CTGAGTGTCTGCCCAAGAGAAGG - Intergenic
1035397825 7:158546673-158546695 CTGAGGGTCTTAGGCAGAGCTGG + Intronic
1037763956 8:21760289-21760311 CTGAGGGTTTGAAGCAGAAAAGG + Intronic
1038583131 8:28767379-28767401 CTGAGGATCTGTGGGAGAGGCGG + Intergenic
1039917197 8:41868901-41868923 ATGAGGCTCAGACGGGGAGAAGG + Intronic
1040386870 8:46920041-46920063 CTGAAGGTCTGATGTAGAAATGG + Intergenic
1040811638 8:51460754-51460776 TGGAGGATCTGCCGGAGAGAAGG + Intronic
1041264706 8:56053083-56053105 CTGAGTTGCTGACGGAGGGAAGG - Intergenic
1041730461 8:61057044-61057066 CAGAGGGTCTGAGGGTGAGGGGG + Intergenic
1045322959 8:101095707-101095729 CTGAGGGAAAGACGGGGAGAGGG - Intergenic
1045945933 8:107796055-107796077 CTGAGGGTCTGAGTGGGAGCAGG + Intergenic
1046937107 8:119895122-119895144 CTGAAAGTCTGAAGGAGAGGGGG - Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048670660 8:136715601-136715623 ATGAGGGTGTGATGGAGAGCTGG + Intergenic
1048752824 8:137698946-137698968 CTAAGGTTTTGAGGGAGAGAGGG - Intergenic
1049204087 8:141355318-141355340 CTGAGGCTCAGAGGGAGAAAGGG - Intergenic
1049473370 8:142786036-142786058 CTGAGGGCCTGACGGAGCTAAGG + Intronic
1049861357 8:144901390-144901412 CTGCGGCTCTGACGGTGAGTGGG - Exonic
1050365039 9:4866208-4866230 CTAAGGGTCAGAAGGACAGAGGG - Intronic
1052117585 9:24668080-24668102 CTGAGGGCCTGACTGTTAGAAGG - Intergenic
1053013868 9:34650899-34650921 CTGAGGGTTTGATGGGGAGCGGG + Exonic
1056431483 9:86532700-86532722 CTGAAGGCCTGATGGAGACATGG + Intergenic
1060101886 9:120847924-120847946 TTGAGGGTGTAAGGGAGAGAGGG - Intergenic
1061373823 9:130212642-130212664 CAGCGTGTCTGAAGGAGAGAGGG + Intronic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1061770928 9:132920793-132920815 CTGAGGGTAAGACTGAGCGAGGG - Intronic
1062708747 9:137960252-137960274 CTGAGGGACACCCGGAGAGAAGG + Intronic
1203384652 Un_KI270438v1:12597-12619 CTGAGGGTCTGCCTGTTAGAAGG + Intergenic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1190732094 X:53233194-53233216 CGGAGATTCTGACGGACAGAAGG + Exonic
1191085454 X:56563364-56563386 GAGAGGGTGAGACGGAGAGAAGG - Intergenic
1192535699 X:71925380-71925402 CTGAGTGACTAACAGAGAGAGGG + Intergenic
1195831622 X:109065709-109065731 CTGGGGGTCTGTCAGAGAGTGGG + Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic