ID: 1002436867

View in Genome Browser
Species Human (GRCh38)
Location 5:179236883-179236905
Sequence ATTTTAGGAGGTGGGGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4656
Summary {0: 2, 1: 51, 2: 480, 3: 1439, 4: 2684}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002436860_1002436867 -10 Left 1002436860 5:179236870-179236892 CCCCAGAGGGATGATTTTAGGAG No data
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684
1002436855_1002436867 16 Left 1002436855 5:179236844-179236866 CCAAAATTCATATGTTGAAACCT 0: 126
1: 631
2: 1974
3: 3403
4: 4728
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684
1002436858_1002436867 -4 Left 1002436858 5:179236864-179236886 CCTAATCCCCAGAGGGATGATTT 0: 1
1: 0
2: 7
3: 56
4: 364
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684
1002436853_1002436867 18 Left 1002436853 5:179236842-179236864 CCCCAAAATTCATATGTTGAAAC 0: 160
1: 945
2: 2221
3: 3621
4: 4553
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684
1002436852_1002436867 19 Left 1002436852 5:179236841-179236863 CCCCCAAAATTCATATGTTGAAA 0: 255
1: 1139
2: 2513
3: 3893
4: 4590
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684
1002436854_1002436867 17 Left 1002436854 5:179236843-179236865 CCCAAAATTCATATGTTGAAACC 0: 123
1: 846
2: 2215
3: 3638
4: 4509
Right 1002436867 5:179236883-179236905 ATTTTAGGAGGTGGGGCCTTTGG 0: 2
1: 51
2: 480
3: 1439
4: 2684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002436867 Original CRISPR ATTTTAGGAGGTGGGGCCTT TGG Intronic