ID: 1002439329

View in Genome Browser
Species Human (GRCh38)
Location 5:179256211-179256233
Sequence CTGGCGGCTTACTGTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002439329_1002439336 10 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439336 5:179256244-179256266 GTCATCTTGTGACCCGCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1002439329_1002439340 19 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439340 5:179256253-179256275 TGACCCGCCCCTGGGGACACGGG 0: 1
1: 0
2: 2
3: 22
4: 142
1002439329_1002439346 30 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439346 5:179256264-179256286 TGGGGACACGGGTGCCCAACAGG No data
1002439329_1002439338 12 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439338 5:179256246-179256268 CATCTTGTGACCCGCCCCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 78
1002439329_1002439339 18 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439339 5:179256252-179256274 GTGACCCGCCCCTGGGGACACGG 0: 1
1: 0
2: 2
3: 12
4: 185
1002439329_1002439337 11 Left 1002439329 5:179256211-179256233 CCCACAGAACAGTAAGCCGCCAG 0: 1
1: 0
2: 1
3: 8
4: 76
Right 1002439337 5:179256245-179256267 TCATCTTGTGACCCGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002439329 Original CRISPR CTGGCGGCTTACTGTTCTGT GGG (reversed) Intronic
901814006 1:11783751-11783773 CTGGTCGTTTACTGTTTTGTGGG + Intronic
904476352 1:30767204-30767226 CTGGCTGCATACTGTTCCTTTGG + Intergenic
908416986 1:63923004-63923026 CTGCCAGCTTCCTGTGCTGTTGG + Intronic
915805431 1:158844008-158844030 CTGGGGGCTTACTCTGCTCTTGG - Exonic
920841862 1:209561959-209561981 CAGGAGGCCTGCTGTTCTGTGGG + Intergenic
920969446 1:210730606-210730628 CTGGAGTCTTACTATTTTGTGGG + Intronic
1066409142 10:35149172-35149194 CTGGCTGCTCCCTCTTCTGTAGG - Intronic
1067970293 10:50962285-50962307 CTTGTGGCTTAATGTTCAGTAGG + Intergenic
1070568692 10:77623987-77624009 CTGGCTGCTTACGGTTCAGGGGG + Intronic
1073217320 10:101843648-101843670 CTGGCGGCCTACTGTGCTGTCGG + Intronic
1075055841 10:119217780-119217802 CTGGCCGCTTACTGCTCCTTAGG + Intronic
1077206551 11:1347326-1347348 CTCGCGGCTTTTTATTCTGTGGG - Intergenic
1080726770 11:34905857-34905879 GTAGCGGCTTACAGATCTGTGGG + Intronic
1083160544 11:60851552-60851574 CTGTCGGCCTGGTGTTCTGTGGG - Exonic
1087386165 11:97471536-97471558 CTAGAGGCTGACTGGTCTGTGGG - Intergenic
1091970156 12:4780017-4780039 CTGGCTGCCCACTGATCTGTGGG + Intronic
1097040966 12:56155681-56155703 CAGGAGGCTTACTGTCCTGCAGG + Intronic
1097961138 12:65532897-65532919 CTGGGGGCTAACTGGTCTGCTGG + Intergenic
1117638079 14:57768448-57768470 TTTGCTGCTTACTCTTCTGTGGG - Intronic
1123468508 15:20533502-20533524 ATGGCGGCTTACTCTTCTCCAGG + Exonic
1123649606 15:22467560-22467582 ATGGCGGCTTACTCTTCTCCAGG - Exonic
1123681530 15:22767737-22767759 ATGGCGGCTTACACTTCTGTAGG + Intergenic
1123728826 15:23128713-23128735 ATGGCGGCTTACTCTTCTCCAGG + Exonic
1123746990 15:23326178-23326200 ATGGCGGCTTACTCTTCTCCAGG + Intergenic
1123761827 15:23439499-23439521 ATGGCGGCTTATGCTTCTGTAGG + Exonic
1124279259 15:28349494-28349516 ATGGCGGCTTACTCTTCTCCAGG + Intergenic
1124303439 15:28562114-28562136 ATGGCGGCTTACTCTTCTCCAGG - Intergenic
1124333745 15:28842194-28842216 ATGGCGGCTTACACTTCTGTAGG + Intergenic
1132325455 15:100965060-100965082 CAGGCAGCTCACTGTTCTGCAGG - Intronic
1137474254 16:48793156-48793178 CTGAGTGCTTACTTTTCTGTGGG - Intergenic
1144801919 17:17935060-17935082 CTGGCTGCTTTCTATGCTGTGGG - Intronic
1146616586 17:34361736-34361758 CTGGCGGGGTTCTGTTCTCTAGG + Intronic
1149569465 17:57662177-57662199 TTGTCTGCTTCCTGTTCTGTAGG - Intronic
1156524882 18:37757635-37757657 CTGTTGGCTCACAGTTCTGTAGG - Intergenic
1158110956 18:53941100-53941122 CTGGGGTCTTCCTGTACTGTGGG - Intergenic
1162124345 19:8491127-8491149 CTGGCGGCTTGCTGAACTGAGGG + Exonic
926086013 2:10020730-10020752 CTGGCAGCTTCCTGGTCTCTGGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG + Intergenic
931669167 2:64631152-64631174 CTGGGGGCTGATTCTTCTGTGGG - Intergenic
935724626 2:106012469-106012491 CTGAAGGCTTAATCTTCTGTTGG + Intergenic
1170685159 20:18563019-18563041 CTTATGGCTTACGGTTCTGTAGG - Intergenic
1181637053 22:24179488-24179510 CTAGGGGCTTAATGCTCTGTGGG - Intergenic
1184772296 22:46604740-46604762 CTGGTGCCATAATGTTCTGTGGG + Intronic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
953664113 3:44913857-44913879 CTGGCTGCTTATGGTTGTGTTGG - Exonic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
967374296 3:188783353-188783375 ATGGCTGCTTAGTATTCTGTGGG - Intronic
970601339 4:17643106-17643128 CAGGGGGGTTACTGCTCTGTGGG + Intronic
971239205 4:24872595-24872617 CTGGGTGCATACTGTTCAGTGGG - Intronic
971239287 4:24873151-24873173 GTGGGTGCATACTGTTCTGTGGG - Intronic
971239292 4:24873187-24873209 GTGGGTGCATACTGTTCTGTGGG - Intronic
971239310 4:24873331-24873353 TTGGGTGCATACTGTTCTGTGGG - Intronic
975694491 4:76998364-76998386 TTGGTGGCTTACAGTTCTGTAGG + Intronic
976056295 4:81071546-81071568 CTGTGAGCTTACTGTTTTGTAGG - Intergenic
980468897 4:133224156-133224178 ATGGCAACTTACTGTTCTATAGG + Intergenic
984749960 4:183262714-183262736 CACGCGGCTTTCTGTTTTGTTGG - Intronic
986392523 5:7299733-7299755 GTGGCGGCTTACACTTCTGTAGG + Intergenic
996687785 5:126303083-126303105 CTGGCCACATACTGTTCTATTGG + Intergenic
998710781 5:144822732-144822754 TTGATGGCTTACTGTTTTGTAGG + Intergenic
1002439329 5:179256211-179256233 CTGGCGGCTTACTGTTCTGTGGG - Intronic
1004736916 6:18416041-18416063 CTGAGGGCTTACAGTTCTGAAGG + Intronic
1007183720 6:39949725-39949747 CTGGCCTCTTACTGTTCTTATGG - Intergenic
1013048569 6:106510915-106510937 GTGGCTTCTTACTGTTCTGGAGG + Intergenic
1013105829 6:107026041-107026063 CTGGCGGCTTACCTTTCTTCAGG - Intergenic
1014198939 6:118587656-118587678 GTGGCGGCTTACTGATCTGAGGG + Intronic
1015000620 6:128209954-128209976 CTGGCAGCTTCCTGTTCTTGCGG - Intronic
1015223160 6:130827562-130827584 CTGGCTGGTTCCTGTTCTTTGGG + Exonic
1017165996 6:151408900-151408922 TTGTCATCTTACTGTTCTGTAGG - Intronic
1019636115 7:2076643-2076665 CTGCAGGCTAACTGTGCTGTGGG - Intronic
1021122637 7:16814530-16814552 CTTGCGGATTATTTTTCTGTTGG + Intronic
1028770955 7:94620945-94620967 CTGTTGGCCTACTGTTCTCTTGG - Intronic
1032591182 7:133193818-133193840 GTGCCTGCTGACTGTTCTGTGGG + Intergenic
1034991290 7:155549487-155549509 CTGGGGGCCTCCTGTCCTGTTGG - Intergenic
1035474972 7:159136875-159136897 CTGGCTGCTTCCTGTCCTGCTGG - Intronic
1035621247 8:1037017-1037039 CTGGACGCTTGCTGTTCTGCTGG + Intergenic
1049418150 8:142504894-142504916 CTGGCTTCTTTCTGTTATGTGGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1062199935 9:135297201-135297223 CAGGCGGCTGCCTGTGCTGTGGG + Intergenic
1062550595 9:137084479-137084501 CTGGCATCTTAATGTTCTGTAGG + Exonic
1187800661 X:23059210-23059232 CTGTTATCTTACTGTTCTGTAGG + Intergenic
1190562359 X:51697801-51697823 CTTCCAGCTTACAGTTCTGTAGG - Intergenic
1197523445 X:127528789-127528811 CTGCTCTCTTACTGTTCTGTTGG + Intergenic
1202129716 Y:21598608-21598630 CTGGCAGCTTAATGATCTCTGGG + Intergenic
1202149793 Y:21834401-21834423 CTGGCAGCTAACTACTCTGTGGG - Intergenic