ID: 1002440253

View in Genome Browser
Species Human (GRCh38)
Location 5:179260638-179260660
Sequence CTGTAGAAACAGTGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 9, 3: 27, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002440253_1002440260 29 Left 1002440253 5:179260638-179260660 CCTGGCTCCCACTGTTTCTACAG 0: 1
1: 0
2: 9
3: 27
4: 248
Right 1002440260 5:179260690-179260712 AGTTTCCTCATCTGTAACGTGGG No data
1002440253_1002440259 28 Left 1002440253 5:179260638-179260660 CCTGGCTCCCACTGTTTCTACAG 0: 1
1: 0
2: 9
3: 27
4: 248
Right 1002440259 5:179260689-179260711 CAGTTTCCTCATCTGTAACGTGG 0: 2
1: 166
2: 1596
3: 5845
4: 12360
1002440253_1002440256 0 Left 1002440253 5:179260638-179260660 CCTGGCTCCCACTGTTTCTACAG 0: 1
1: 0
2: 9
3: 27
4: 248
Right 1002440256 5:179260661-179260683 CTTACTATCTGTGCGACCGTCGG 0: 1
1: 1
2: 9
3: 204
4: 1241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002440253 Original CRISPR CTGTAGAAACAGTGGGAGCC AGG (reversed) Intronic
901233043 1:7651860-7651882 ATTTAGAAACAGTGGGAGACCGG - Intronic
902295411 1:15463516-15463538 CTGCAGAGTAAGTGGGAGCCAGG + Exonic
902298303 1:15483394-15483416 CTGCAGAGTAAGTGGGAGCCAGG + Exonic
902400145 1:16153009-16153031 CTCTGGAAAGGGTGGGAGCCTGG + Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
904899869 1:33848412-33848434 CAGGAGAATCAGTGGGAGACTGG - Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
907506866 1:54925477-54925499 CTGTAGAATCAGTGTGGGTCAGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
909088258 1:71193439-71193461 CTGTAATATGAGTGGGAGCCAGG + Intergenic
909711179 1:78651250-78651272 ATGTAGAATCAGCGGGAACCCGG + Intronic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
914830106 1:151165119-151165141 CTGGAGCATCAGTTGGAGCCCGG - Exonic
916071210 1:161171116-161171138 CTGTATAGAGAGTGGGCGCCAGG + Exonic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
917717210 1:177750377-177750399 CTTTAGAAACAGTGAGATCTTGG - Intergenic
918371276 1:183863854-183863876 CTGTAGACACTCTGGTAGCCAGG + Intronic
919002694 1:191853743-191853765 GTGGAGCAAAAGTGGGAGCCAGG + Intergenic
919621403 1:199868104-199868126 CTATACAAACAGTGTGTGCCAGG + Intergenic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
920860056 1:209698566-209698588 CTGTTGAAACATTGGCAGCATGG - Intronic
921826598 1:219679086-219679108 ATGTAGAAACAGTGGGAACCCGG + Intergenic
922378661 1:224997315-224997337 CTGTAGAAACTGTGGGCCCTGGG + Intronic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
922799139 1:228356436-228356458 CTGCTGAAACAGTGGGACCACGG - Intronic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
1062933759 10:1369811-1369833 AAGTACAAAAAGTGGGAGCCAGG - Intronic
1064269673 10:13853534-13853556 CTGAAAAAAAAGTGGGGGCCAGG + Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064589676 10:16875991-16876013 CTTTACAAACTGTGGGAGTCAGG + Intronic
1065754650 10:28920083-28920105 TTGTAGAATCAGTGGGAGTGTGG + Intergenic
1068779866 10:60907812-60907834 CAGTGGAAAGAGTGAGAGCCAGG + Intronic
1070603835 10:77884489-77884511 CTGTAGAAACAATGTGCTCCGGG - Intronic
1070648764 10:78220084-78220106 CTGTGGACACAATGGGAGTCTGG + Intergenic
1071061004 10:81570851-81570873 CTACAGAGCCAGTGGGAGCCAGG - Intergenic
1072411247 10:95203986-95204008 CTGGGGAAACACTGGGAGCCTGG - Intronic
1072616162 10:97050002-97050024 CTGTACAAACCGAGGCAGCCTGG + Intronic
1073489531 10:103843802-103843824 TGGCAGCAACAGTGGGAGCCAGG - Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1076778515 10:132711149-132711171 CTGAAGAGTCAGTGGGAGCGTGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077343582 11:2036598-2036620 CCGTAGCAAGTGTGGGAGCCAGG + Intergenic
1082833160 11:57634348-57634370 CTGGAGATTCAGTGGGAACCTGG - Intergenic
1082879211 11:58021834-58021856 CTAGAGAAGCAGTGGGAGGCAGG + Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083399086 11:62411553-62411575 CTGCAGAAACAGGGAAAGCCAGG + Intronic
1085625694 11:78070784-78070806 ATGCACAGACAGTGGGAGCCCGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1087216865 11:95504122-95504144 ATCTAGAAGCAGTGGGAGCTTGG + Intergenic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1088500183 11:110475067-110475089 ATGTAGAAACATGGGGAGCCAGG + Intergenic
1089002880 11:115067017-115067039 CTGGAGGAGCAGTGGGTGCCTGG - Intergenic
1090602462 11:128387298-128387320 CTGGAGAAGCAGTGGGTGACAGG - Intergenic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1091046373 11:132329428-132329450 CTGTAGAAATGCTGGGAGGCTGG - Intronic
1202826568 11_KI270721v1_random:91787-91809 CCGTAGCAAGTGTGGGAGCCAGG + Intergenic
1091668708 12:2437592-2437614 CATTAGCAACAGTCGGAGCCTGG - Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1091911011 12:4230718-4230740 TGGCAGAATCAGTGGGAGCCCGG + Intergenic
1093529879 12:20148063-20148085 CTATATAAAAAGAGGGAGCCAGG - Intergenic
1094375981 12:29787669-29787691 CAGAAGCAACAGTGGCAGCCCGG + Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1096018128 12:48296901-48296923 CTGGAGAAAGACTGGGCGCCTGG - Intergenic
1098401026 12:70075871-70075893 CGGTAGAAAGTGAGGGAGCCTGG - Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101381153 12:104215247-104215269 CTGAAGTGACAGTGGAAGCCAGG + Intergenic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102684988 12:114717689-114717711 CTGTGGAATTTGTGGGAGCCAGG + Intergenic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103505330 12:121439211-121439233 GTGTTGAGACAGTGGGGGCCGGG - Intronic
1104742389 12:131188279-131188301 CTATGGAGCCAGTGGGAGCCAGG + Intergenic
1106125741 13:26898588-26898610 CTGTAGAAACGTTGGGGGCAAGG + Intergenic
1106498002 13:30299081-30299103 CAAGAGGAACAGTGGGAGCCTGG + Intronic
1111462800 13:88567890-88567912 CTATAGAAACAGTGGGTTCAGGG + Intergenic
1113823446 13:113231989-113232011 CAGTAGTAACAGTGGTAGGCGGG - Intronic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1114624273 14:24118546-24118568 CTGGAGAGTCAGTGGAAGCCTGG - Intronic
1116532401 14:45988725-45988747 CTGTAGAAGCTGTGGGACCAAGG + Intergenic
1117471264 14:56047935-56047957 CACTAGAAACAGTGCAAGCCAGG + Intergenic
1117552764 14:56852370-56852392 CTGGACAAAAAGTGAGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122020945 14:98837448-98837470 GTGGAGAAAGAGTGTGAGCCTGG - Intergenic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1126486546 15:49187752-49187774 TTGGGTAAACAGTGGGAGCCAGG - Intronic
1126794353 15:52247881-52247903 GTGGAGACACAGTGTGAGCCAGG - Intronic
1127543927 15:59971864-59971886 CTATAGAAATAATGGGAGCAGGG + Intergenic
1127725534 15:61745607-61745629 AGGCAGATACAGTGGGAGCCAGG - Intergenic
1135039945 16:19110620-19110642 CTTTACAAAAAGTGTGAGCCAGG + Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1140094355 16:71862179-71862201 CTTAAGGAACAGTGGGAGCCAGG + Intronic
1142112237 16:88339127-88339149 CTGGAGCGAGAGTGGGAGCCAGG + Intergenic
1142180116 16:88664173-88664195 CTCTAGAAATAGTGGGGGCGTGG - Intergenic
1142439550 16:90086916-90086938 CTGTAAAAACAGTCGGTGACTGG - Intronic
1142910258 17:3083228-3083250 CTGTAGAAACTGTGGGCCCAGGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143758766 17:9085926-9085948 GTGTAGTAGCAGTGAGAGCCAGG - Intronic
1146576935 17:34002385-34002407 CTGTAGCATCAGTTGGATCCAGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147578094 17:41613910-41613932 CTGTAGAAACAGGACTAGCCGGG + Intronic
1148533753 17:48420664-48420686 CTGGAGAATCAGGGGGTGCCAGG - Intronic
1150950767 17:69800927-69800949 CCATGGAACCAGTGGGAGCCAGG + Intergenic
1151521282 17:74632135-74632157 CTGGAGCAAAAGTGTGAGCCGGG - Intergenic
1152556247 17:81054585-81054607 ATGTAGAAACTGTGGGATCAGGG + Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1158445692 18:57518522-57518544 CCTTGGAGACAGTGGGAGCCTGG - Intergenic
1161000487 19:1908254-1908276 CCGGAGATGCAGTGGGAGCCGGG - Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1162502544 19:11062304-11062326 TGGCAGAAACGGTGGGAGCCAGG - Intronic
1164888020 19:31799786-31799808 CTGAAGAAACAGTGGAGCCCAGG + Intergenic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1167611959 19:50512053-50512075 CTGCAGAACTAGTGAGAGCCCGG + Intronic
1168511809 19:56979636-56979658 CTGTTGCAACACTCGGAGCCAGG + Intergenic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
928306736 2:30176513-30176535 CAGTAGGACCAATGGGAGCCGGG - Intergenic
928843940 2:35645788-35645810 ATGAAGAAAAAGTGGCAGCCAGG + Intergenic
929867551 2:45731035-45731057 ATGTGGGAATAGTGGGAGCCTGG + Intronic
929904872 2:46036904-46036926 TTGTAAAACCAGTGGAAGCCTGG + Intronic
931135835 2:59399515-59399537 CTGTAGAAACTGTGGGACCAGGG - Intergenic
931192965 2:60023405-60023427 GTGTAGAACCACTGGGATCCCGG - Intergenic
931345800 2:61445000-61445022 CTGTATAAACAATGGAAGCCAGG + Intronic
931832416 2:66066418-66066440 GTATGGAGACAGTGGGAGCCCGG + Intergenic
932086140 2:68764056-68764078 CTGTAGAGACAGTGGTTGCCAGG - Intronic
933902331 2:86859061-86859083 CTGTACATCCAGTGGCAGCCAGG - Intronic
934147694 2:89111567-89111589 CTTTAGAAACCTTGGGAGGCTGG + Intergenic
934221581 2:90089034-90089056 CTTTAGAAACCTTGGGAGGCTGG - Intergenic
935217835 2:100988748-100988770 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217866 2:100988840-100988862 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935217921 2:100988988-100989010 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935778214 2:106490207-106490229 CTGTACATCCAGTGGCAGCCAGG + Intergenic
937000116 2:118458068-118458090 CAGTAGAAACAGTGTGTGCATGG + Intergenic
942554776 2:177160569-177160591 TTCTAGAGGCAGTGGGAGCCAGG - Intergenic
942963734 2:181864122-181864144 TTCTAAAAATAGTGGGAGCCAGG - Intergenic
944594760 2:201250948-201250970 CTATAGAGACAGTGGTTGCCAGG - Intronic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
948712880 2:239836230-239836252 CCATAGAGCCAGTGGGAGCCAGG + Intergenic
1168753629 20:300784-300806 CTGTTGAAAAAGCGGGATCCAGG + Intergenic
1169933077 20:10854715-10854737 CTGGAGAAAAAGTGTGAGACAGG - Intergenic
1170470630 20:16664560-16664582 CTGTTGGGACAGTGGGATCCTGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173466690 20:43288528-43288550 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1173980909 20:47223411-47223433 CAGGAGAATCAGTGGAAGCCAGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1177404209 21:20645313-20645335 CTGTGGAGCCTGTGGGAGCCAGG + Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179438865 21:41379650-41379672 CTGCAGAAAGACGGGGAGCCTGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1182760912 22:32721651-32721673 CTGTACCACCAGTGGGAGCTGGG - Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183392431 22:37553045-37553067 GTGTGCAAACAGTGAGAGCCAGG - Intergenic
1183580122 22:38719755-38719777 TTGTAAAAACAGTAGGAGACAGG - Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1185122044 22:48977162-48977184 GTGTTGACACAGTGGCAGCCCGG + Intergenic
1185161419 22:49232200-49232222 CTGCAGAAACAGTGGATGTCAGG - Intergenic
949564298 3:5230712-5230734 ATGTAGAATCAGTGGGAGCCCGG - Intergenic
949698419 3:6726893-6726915 CTGTAGAAATAGTGGTTGACAGG + Intergenic
950722045 3:14890393-14890415 CGGAGGAAACAGTGGGAGCATGG - Intronic
951566991 3:24020465-24020487 CTGTGGAGCCAGTGGGGGCCAGG - Intergenic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
954820901 3:53326741-53326763 ATGTAGAATCAGTGGGAGCCTGG - Intronic
954962485 3:54578589-54578611 CTGTATCACCAGAGGGAGCCGGG - Intronic
956723769 3:72140231-72140253 ATGTAGAATCAGTGGGAGCTTGG + Intergenic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
959980017 3:112505502-112505524 CTATAGAAACAGTGGTTGCCAGG - Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
963350170 3:144141801-144141823 TTGGAGAAGCAGTGGGAACCAGG - Intergenic
964195049 3:154054149-154054171 CAGTGAAAACAGTGGTAGCCTGG + Intergenic
965486177 3:169281287-169281309 GTGTAGAAATAGCGGGACCCTGG + Intronic
968231475 3:197007298-197007320 CTTTAGAATCAGTGGGATGCTGG - Intronic
969136148 4:5030511-5030533 ATGTGGATACAGTGTGAGCCGGG + Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970600415 4:17637320-17637342 CTGAAAAAGCAGTGGGGGCCGGG - Intronic
971255542 4:25010385-25010407 CTGAATAAACAGTGGGTGACTGG + Intronic
971273323 4:25171917-25171939 CTGGAGCAACAAGGGGAGCCAGG - Intronic
973152056 4:46900453-46900475 CTGGTGAGACAGTGAGAGCCAGG - Intronic
973811257 4:54572398-54572420 CAGTGGATACAGTGGGATCCAGG - Intergenic
973992247 4:56421292-56421314 ATCTAGAATCAGTGGGAGCCCGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
979631278 4:122905730-122905752 TTGAAGAAACTGTGGAAGCCAGG - Intronic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
982727602 4:158921860-158921882 ATGTAGAAGGAATGGGAGCCAGG - Intronic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990759929 5:59117720-59117742 CTGTTGAACCAGTGGTAGCTTGG + Intronic
990977559 5:61572907-61572929 TTTGAGAAACCGTGGGAGCCTGG + Intergenic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
994102165 5:95905438-95905460 CTGGAGAAGCAGTGAGAGTCAGG - Intronic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997640293 5:135444552-135444574 CAGTAGATACAGTGGAAGACAGG + Exonic
997757917 5:136417566-136417588 CAGAAGAAAGAGTGTGAGCCAGG + Intergenic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
999887309 5:155937222-155937244 CTATGGAGCCAGTGGGAGCCGGG - Intronic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1004113356 6:12743283-12743305 CTTTAGCAAAAGTGGGAGACTGG - Intronic
1004258702 6:14088901-14088923 CTGAAGAAGCAGTGGCCGCCTGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1005575766 6:27187967-27187989 GTGTATAAAGAGTGGGGGCCAGG - Intergenic
1005576662 6:27196175-27196197 GTGTATAAAGAGTGGGGGCCAGG - Intergenic
1006370900 6:33643093-33643115 CAGTGGAAACAGTGAAAGCCAGG - Intronic
1006829049 6:36957945-36957967 CTCTGGCAACAGTGGGAGACTGG - Intronic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1007928204 6:45667314-45667336 CTGGAGGAACAGTGGCAGTCAGG + Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1010769724 6:79814514-79814536 TGGTAAAAACAGTGTGAGCCTGG + Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1014191082 6:118497436-118497458 ATGTAGAATCAGTGGGAGCCCGG - Intronic
1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG + Intronic
1018306939 6:162467772-162467794 CTGGAGGACAAGTGGGAGCCAGG - Intronic
1019115201 6:169754914-169754936 TTGTATATACAGTGTGAGCCTGG + Intronic
1021500887 7:21330524-21330546 TCGTAGAGCCAGTGGGAGCCAGG - Intergenic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1024512208 7:50213037-50213059 CTACAGAAAGAGTGGGAGGCAGG + Intergenic
1024620215 7:51150568-51150590 CTGGAGAAACTATGGGAGTCAGG + Intronic
1027044185 7:74980809-74980831 CTGGAGAAACTCTGGGGGCCAGG + Intronic
1027079457 7:75221549-75221571 CTGGAGAAACTCTGGGGGCCAGG - Intergenic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029591570 7:101510537-101510559 CTGCAGAGACAGGGCGAGCCTGG + Intronic
1029649389 7:101880482-101880504 CTGTATAAAGAGTGGGAACTGGG + Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034071109 7:148186622-148186644 ATGAAGAAACAGTGGGTGTCTGG + Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034685308 7:152966012-152966034 ATGTAGAATCTGTGGGAGCCCGG + Intergenic
1034848247 7:154467703-154467725 CTGTAGAAACATTGCCAGCTTGG - Intronic
1036806973 8:11841819-11841841 CTTTAAAAAGAGTGGCAGCCGGG + Intergenic
1037472395 8:19223615-19223637 CAGTAGAGACTGTGGGAGGCAGG + Intergenic
1037567284 8:20128521-20128543 CTGCAGAAACAGTGTAAGCTGGG + Intergenic
1037687692 8:21157649-21157671 ATCAAGAAACAGTGGGATCCTGG - Intergenic
1038206964 8:25475981-25476003 CTGTAGAAACTGTGGGTCCAGGG + Intronic
1038307175 8:26415237-26415259 GTCTAAAAAAAGTGGGAGCCAGG + Intronic
1038863605 8:31414613-31414635 ATGTAGAATCAGTGGGAGTCTGG + Intergenic
1041530476 8:58860176-58860198 CATTAGAAACAGTGGCAGCTAGG - Intronic
1042863040 8:73332977-73332999 CTGGAGAAACCATGGAAGCCAGG - Intergenic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1044872897 8:96637923-96637945 CTTTAGAAACAGGGAGACCCAGG - Intergenic
1049595167 8:143480084-143480106 AGGTAGCAACAGTGGGGGCCGGG + Intronic
1049780737 8:144427711-144427733 GTGGAGAAACAATGGGAGCGGGG + Intronic
1050328751 9:4523724-4523746 CTGTACTTACAGTGTGAGCCAGG + Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052589792 9:30477201-30477223 ATGTAGAATCGGTGGGAGCCTGG - Intergenic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1052736676 9:32349633-32349655 AGGTTGAGACAGTGGGAGCCTGG + Intergenic
1053396904 9:37783765-37783787 CTGAAGAAACTCTTGGAGCCTGG + Intronic
1055150002 9:72985440-72985462 CCCTAGAGACAGTGGGAGCCAGG + Intronic
1055435814 9:76291030-76291052 CAGTAGAAACAGTGCTGGCCTGG - Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055891025 9:81123198-81123220 CCATGGAACCAGTGGGAGCCAGG - Intergenic
1056475672 9:86948740-86948762 CTCCAGAAGCAGAGGGAGCCGGG + Intergenic
1057199047 9:93130717-93130739 CTTTCAAAACAGTGAGAGCCAGG - Intronic
1058598096 9:106637725-106637747 CTGTACAAGCTGTGGGAGCAGGG + Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061978297 9:134084668-134084690 CTTCAGAAACAGTGGGGCCCTGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1185840955 X:3390810-3390832 ACGTAGGATCAGTGGGAGCCCGG - Intergenic
1185985351 X:4826658-4826680 ATGTAGAATCAGTGGGAGCCTGG + Intergenic
1188604585 X:32012462-32012484 TTGAAGAAACAGTAGCAGCCGGG - Intronic
1188756390 X:33968924-33968946 CTGCAGAGCCAGTGGGAGCTGGG + Intergenic
1193057762 X:77172790-77172812 ATTTGGAAACAGTGGGAGGCAGG + Intergenic
1193677889 X:84479251-84479273 TTATAGAAACAGTGGTTGCCAGG - Intronic
1195219159 X:102730094-102730116 ATGTAGAATCACTGGGAGCCCGG + Intronic
1198020114 X:132649338-132649360 CTGTAGACATAGTGTGAGTCAGG + Intronic
1198889493 X:141377287-141377309 CTGTAGAAACCTTGGGACCAGGG - Intergenic
1200022517 X:153224141-153224163 ATGTAGAATCAGCGGGAGCCTGG + Intergenic
1201577485 Y:15476794-15476816 ATGTAGAATCAGTGGGAGCCCGG + Intergenic
1201693371 Y:16794449-16794471 ATGTAGAATCAGTGGGAACATGG - Intergenic
1201920260 Y:19226345-19226367 ATGAAAACACAGTGGGAGCCTGG - Intergenic