ID: 1002440434

View in Genome Browser
Species Human (GRCh38)
Location 5:179261802-179261824
Sequence TCTGGGGTCCCTCCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002440423_1002440434 25 Left 1002440423 5:179261754-179261776 CCTAAGTACGTGCAGGCCACAGT 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG 0: 1
1: 0
2: 3
3: 25
4: 255
1002440428_1002440434 -6 Left 1002440428 5:179261785-179261807 CCATTCATCCCGGCCAGTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG 0: 1
1: 0
2: 3
3: 25
4: 255
1002440426_1002440434 1 Left 1002440426 5:179261778-179261800 CCTGCATCCATTCATCCCGGCCA 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG 0: 1
1: 0
2: 3
3: 25
4: 255
1002440424_1002440434 9 Left 1002440424 5:179261770-179261792 CCACAGTTCCTGCATCCATTCAT 0: 1
1: 0
2: 12
3: 344
4: 3211
Right 1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG 0: 1
1: 0
2: 3
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002440434 Original CRISPR TCTGGGGTCCCTCCCCACAG TGG Intronic
900309006 1:2024545-2024567 CCTGGGGTCCCTCACCAAAGAGG - Intronic
900386649 1:2413730-2413752 ACTGGAGGCCCTCCCCACTGAGG - Intronic
900740220 1:4326625-4326647 TGTGGGGTCCCTGCCCACAGAGG - Intergenic
900767293 1:4513928-4513950 CCTGGTTTCCCTCCCCACACTGG - Intergenic
901078663 1:6571353-6571375 TCAGGGGTCCCTGCCCAGCGTGG + Intronic
902404933 1:16177428-16177450 TCTGGGGCCCTTGCACACAGGGG - Intergenic
903338224 1:22638813-22638835 TCTGGCATTTCTCCCCACAGGGG + Exonic
903936742 1:26900590-26900612 TCTGTGTTCCTTTCCCACAGAGG + Intronic
904537334 1:31208542-31208564 TCTGGGATCCCCACCCCCAGGGG - Intronic
906723383 1:48025434-48025456 GCTGGGGTCCCAACCCAGAGGGG - Intergenic
907990561 1:59578406-59578428 TTTGGGGTTCCTCCATACAGGGG - Intronic
910208371 1:84770302-84770324 TCTGGGCTCCCTCCTGCCAGAGG + Intergenic
910934455 1:92476079-92476101 TCTGGAAACCCTTCCCACAGAGG + Exonic
910979343 1:92943655-92943677 TCTGGGGTCCCTCGTGCCAGCGG - Intronic
911301955 1:96185381-96185403 ACTGGGGTATCTCACCACAGTGG - Intergenic
912502903 1:110134020-110134042 TATGGGGCCCCTCTACACAGTGG - Intergenic
912543588 1:110434973-110434995 ACTGGAGTCCCTCTCCCCAGTGG - Intergenic
912637787 1:111314801-111314823 TTTGGGGGCCCTATCCACAGAGG + Intronic
913550799 1:119915567-119915589 TGTGGGGTACTTGCCCACAGAGG + Exonic
913566040 1:120073459-120073481 GCTGGTGTCCCTCTACACAGAGG - Intergenic
913632093 1:120720094-120720116 GCTGGTGTCCCTCTACACAGAGG + Intergenic
915538141 1:156550131-156550153 TCTGGCCTGCCTCCCCACAGAGG + Intronic
916384304 1:164249985-164250007 TTTGGGCTCCGGCCCCACAGTGG - Intergenic
917305249 1:173617644-173617666 TCGGTCATCCCTCCCCACAGTGG - Intronic
919529721 1:198701912-198701934 CCAGGGATCCCTCCCCAGAGAGG + Intronic
1068157877 10:53224050-53224072 ACAGGGGTCCCTCTCCACACAGG - Intergenic
1069788622 10:71005440-71005462 TATGGGGAACTTCCCCACAGAGG - Intergenic
1070755788 10:78992534-78992556 TCTAGGCTCCTTCCCCTCAGGGG + Intergenic
1070843245 10:79502689-79502711 TCTGGGTCCCCACCCCACAGAGG + Intergenic
1073302756 10:102480963-102480985 TCTGGGTTTCCTCCCTCCAGGGG - Exonic
1074932194 10:118139656-118139678 TCTGGAGCCCCTCCCCACCCAGG + Intergenic
1075672108 10:124269908-124269930 GCTGGGATCTCTCCCCACAGCGG - Intergenic
1076153849 10:128187668-128187690 TCTCGGGTTCCTCCCCACCAGGG + Intergenic
1076516835 10:131050478-131050500 TCTGGAGTCCCTGGCCTCAGGGG - Intergenic
1076736377 10:132460998-132461020 CCTGGGGGTCCTCCCCAGAGTGG + Intergenic
1076886721 10:133266505-133266527 TCCGGGGACCCCCTCCACAGAGG - Intronic
1077205012 11:1337745-1337767 CCTGGGGTCCCTCCCCGCGGTGG - Intergenic
1077295585 11:1824997-1825019 CCTGGGGTCCCTCTCCACAGGGG - Intergenic
1077402914 11:2367862-2367884 TCAGGGGTCCCTCCTCACAGGGG + Intergenic
1077500513 11:2907955-2907977 TCTGGGGGCACGCCCCAGAGAGG - Intronic
1077500519 11:2907971-2907993 TCTAGGGTCCTTCCCCTCTGGGG - Intronic
1077516543 11:3005469-3005491 TCTGTGGGCCGTCCCCACTGCGG + Intronic
1078210260 11:9264902-9264924 TCTGGGGTCCCCGACGACAGCGG + Intronic
1078368259 11:10724111-10724133 TATGAGTGCCCTCCCCACAGTGG - Intergenic
1080605574 11:33862200-33862222 TCCAGGGTCCCTCCCCTCTGAGG - Intronic
1080644895 11:34181391-34181413 TCTGGGGTCCCTGCCTACCCCGG - Intronic
1080972851 11:37300217-37300239 TCTGGCACCCCTCCTCACAGAGG - Intergenic
1081795716 11:45817992-45818014 ACTGGGGTCCAACCTCACAGGGG + Intergenic
1083434674 11:62634226-62634248 TCTGGGGCACCTCCCCCCAAAGG + Intronic
1083721317 11:64604978-64605000 TCTTGGGACCCTCCCCACCATGG - Intergenic
1083729951 11:64647517-64647539 TTTGAGGCCCCTCCCCAGAGAGG - Intronic
1083775599 11:64893098-64893120 CCTGGCGGCCCTTCCCACAGAGG + Intergenic
1083778004 11:64903552-64903574 ACTGGGCTCCCTCCCCTCTGAGG - Intronic
1083778491 11:64906262-64906284 ACTGGGGTCCCACCGCACACCGG + Intronic
1083997680 11:66280094-66280116 TGTGGGGTCCCTGTCCTCAGGGG + Intronic
1084650884 11:70488576-70488598 CCTGGGCTCCCTCCCCTCAGGGG - Intronic
1084947882 11:72648611-72648633 TATGGGTTCCCTTCCCCCAGAGG - Intronic
1085063923 11:73474519-73474541 TCTGGGGGCCCTGTCCTCAGGGG - Intronic
1085126217 11:74004429-74004451 TCTGGGTTCCCTCCCTGCTGAGG + Intronic
1085795562 11:79536564-79536586 TCTGGGTTTCCCCCTCACAGAGG - Intergenic
1088011009 11:105001078-105001100 CCTGTGTTCTCTCCCCACAGAGG + Intronic
1088961366 11:114669141-114669163 TCTGTGGACCCTCTCCCCAGTGG + Intergenic
1089737077 11:120556929-120556951 TCTGGCCTCCCTCCTGACAGCGG + Intronic
1090076220 11:123581524-123581546 TCAGGGACCCCTGCCCACAGTGG + Intronic
1092830969 12:12443915-12443937 TCTGGGGTTCCTCACAAGAGAGG - Intronic
1092911739 12:13151686-13151708 TCTTGGGTTCCTCCCCCCGGAGG - Intergenic
1093244601 12:16720951-16720973 TCTGAACTCCCTTCCCACAGTGG - Intergenic
1093620055 12:21277894-21277916 CCTGGGGTCCCTACCCACACTGG - Intronic
1094288153 12:28817214-28817236 ACTGCAGACCCTCCCCACAGGGG - Intergenic
1095878415 12:47106645-47106667 TATGGGGCCCCTCCCCACAAGGG + Intronic
1097194741 12:57237138-57237160 CCTGGGGTCCCGCCCCTGAGTGG + Exonic
1097232359 12:57520558-57520580 TTTGGGGTCCCGCCCCTGAGAGG - Intergenic
1100686235 12:96989175-96989197 TCTGGGGTGCTTCCCAACTGTGG + Intergenic
1101584162 12:106070117-106070139 TCTGAGGTGCCACCCCACAGTGG - Intronic
1101802283 12:108032899-108032921 TATGTGGTCCCTGCCCTCAGGGG - Intergenic
1101859378 12:108470433-108470455 TTGAGGGGCCCTCCCCACAGGGG - Intergenic
1103040566 12:117691816-117691838 CCTGAGGGCCCTCCCCACACTGG + Intronic
1103852237 12:123940786-123940808 TCTGGGGTCACAGCCCCCAGGGG + Intronic
1105440848 13:20414810-20414832 ACTGAGGTCCCTCCCGTCAGAGG + Intronic
1106024090 13:25940739-25940761 GCAGGCGGCCCTCCCCACAGAGG + Intronic
1113994764 14:16056750-16056772 TCTCGGTGCCCTCCCCACTGGGG + Intergenic
1114223931 14:20721764-20721786 CCTGGTGCTCCTCCCCACAGAGG - Intergenic
1118004347 14:61552391-61552413 GCTGGGTTCCCTCAGCACAGTGG + Intronic
1119651809 14:76389228-76389250 TCAGGGATGCCTCCACACAGAGG - Intronic
1119765859 14:77187344-77187366 TCTGGGCGCCCTGCCCAGAGTGG - Intronic
1119995716 14:79251599-79251621 TCTGGGGTTCCTCCACTTAGAGG + Intronic
1121110815 14:91311606-91311628 TGTGGGGACCCTGCCCACATGGG - Intronic
1121515246 14:94545312-94545334 AGAGGGGCCCCTCCCCACAGGGG - Intergenic
1122910009 14:104822985-104823007 GCTGGCTGCCCTCCCCACAGGGG + Intergenic
1123113541 14:105883760-105883782 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1123115770 14:105893397-105893419 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1123117799 14:105902506-105902528 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1123120013 14:105912112-105912134 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1123402752 15:20003695-20003717 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1123512090 15:21010349-21010371 TGAGGGAACCCTCCCCACAGAGG + Intergenic
1124223003 15:27865938-27865960 TCTGGGTTTCCTGCCTACAGAGG - Intronic
1124264226 15:28219347-28219369 CCTGGGGCCTTTCCCCACAGAGG - Intronic
1124499031 15:30210524-30210546 TCTGGGGTCCCAACCTCCAGTGG + Intergenic
1127047681 15:55043923-55043945 TCTGGGGAGGCTCCCCACTGTGG - Intergenic
1128389060 15:67170664-67170686 TCAGGGCCCCCTCCCCACACTGG - Intronic
1128682902 15:69664467-69664489 TCTGGGGCCACTCCCCAGAAAGG + Intergenic
1130735692 15:86546139-86546161 TCTGATGTCATTCCCCACAGCGG - Intronic
1130988114 15:88857953-88857975 TCTGGGGTCCCTGATCTCAGTGG + Exonic
1131036436 15:89225493-89225515 TCTTGGGCCCTTCCCCAGAGAGG + Intergenic
1131122948 15:89834405-89834427 CCAGAGGTCCCTCCTCACAGAGG - Exonic
1131508560 15:93036455-93036477 CCAGGGGTCCCTCCCCAGGGTGG - Intronic
1132416242 15:101621036-101621058 CCTGGGGATCCTCTCCACAGGGG - Intergenic
1132622478 16:874378-874400 TCTGAGGCGCCTGCCCACAGCGG - Intronic
1132688620 16:1172529-1172551 TCGGGGTTCCCTCCACAGAGCGG - Intronic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1133177535 16:4026623-4026645 ACTGTGGTCCCTCCCCACAATGG + Intronic
1133352033 16:5108087-5108109 ACTGGGGTCCCTTTCCACACTGG - Intergenic
1133631830 16:7629275-7629297 TGTGGGGTCCTGCCACACAGAGG - Intronic
1135518752 16:23157224-23157246 TCTGGGGACCATCCAGACAGAGG + Intergenic
1136004932 16:27322995-27323017 TTGGGGGTCCCTGCCCACAAAGG + Intronic
1136228974 16:28876117-28876139 TCGGGGATCCCTTCCCACAGGGG - Intergenic
1136289763 16:29264551-29264573 GCTGGGGTCCCTCCAGACAATGG - Intergenic
1139281106 16:65771274-65771296 TCTAGGTGCCCTCTCCACAGCGG + Intergenic
1140251829 16:73301154-73301176 TCTTGGGGCCATCCCTACAGAGG + Intergenic
1140663481 16:77209397-77209419 CCTTGGTTCCTTCCCCACAGAGG + Exonic
1140721278 16:77774629-77774651 TCTGGGGCTCATCCCCACTGGGG - Intergenic
1141717655 16:85736048-85736070 GCTGGGGCCCCACCCCACAGGGG + Intronic
1142095644 16:88238027-88238049 GCTGGGGTCCCTCCAGACAATGG - Intergenic
1142198208 16:88748522-88748544 ACTGAGGTCCAACCCCACAGCGG + Intronic
1142686248 17:1578395-1578417 CCTGGGGGCCCTCACCCCAGGGG + Intronic
1143595163 17:7909587-7909609 TCTGTGTCCCCTCCACACAGTGG + Intronic
1143784962 17:9249130-9249152 TCTGGTGTCTCTGTCCACAGGGG + Intergenic
1145280189 17:21462447-21462469 CCTGGAGGCCCTCCGCACAGCGG + Intergenic
1147443642 17:40462136-40462158 TGTGGGGTCCCTCTTCGCAGGGG + Intergenic
1148588667 17:48799221-48799243 AGAGGGCTCCCTCCCCACAGTGG + Intronic
1151313682 17:73309693-73309715 CCTAGGGTCCCTGCACACAGAGG - Intronic
1151757570 17:76083410-76083432 CCTGGGGTCCCTCCACACCTTGG - Exonic
1152301176 17:79495867-79495889 TGCAGGGTCCCTGCCCACAGGGG - Intronic
1152644643 17:81463155-81463177 TCCCAGGTCCCTCCCCACAGTGG + Intronic
1152854165 17:82654425-82654447 TTTGGAATCCCTCTCCACAGTGG + Intergenic
1152942044 17:83177924-83177946 TCTTGGCTCTGTCCCCACAGAGG - Intergenic
1154994784 18:21629849-21629871 TCTGTGGCACCTACCCACAGGGG + Exonic
1159207137 18:65267192-65267214 TTAGGGGTCACTGCCCACAGGGG - Intergenic
1160704166 19:521846-521868 TCTTGGGACCCTCCCCAAAGAGG - Intergenic
1161239952 19:3217057-3217079 ACTGTGGTCCATCCACACAGTGG + Intergenic
1161390819 19:4019366-4019388 TCTGGGGTCCCTGCCCTGGGAGG - Intronic
1162433509 19:10643259-10643281 TCTGGGACCTCTCTCCACAGTGG + Exonic
1164087565 19:21917600-21917622 TGTCTGGTCCCTGCCCACAGGGG + Intergenic
1164100198 19:22047991-22048013 TGTGTGGTCCCTGCCCACAGGGG - Intergenic
1164314472 19:24074820-24074842 TCTGTGAGCCCTACCCACAGGGG + Intronic
1164690194 19:30205156-30205178 TCCTGTGTCCCTCACCACAGAGG + Intergenic
1164857857 19:31538933-31538955 TCATGGGTCCCTCTCCCCAGTGG + Intergenic
1165669343 19:37662347-37662369 TGCGGGCTCCTTCCCCACAGGGG - Intronic
1166128613 19:40731795-40731817 TCTTAGGACCCTCCCCAGAGAGG - Intronic
1166231152 19:41426520-41426542 GCTGGGGTCCCTGCCCAGTGGGG - Exonic
1168254731 19:55159180-55159202 TGTGGGGTCCCACCCTGCAGAGG + Exonic
1168489325 19:56795218-56795240 TCCTGGGTCCCTCCCTGCAGGGG + Intronic
926735825 2:16072668-16072690 TGTGGGCTCCTTCCCCGCAGAGG + Intergenic
928234949 2:29531207-29531229 TCTGGGGTCCCTCAACGCTGAGG + Intronic
929764399 2:44832169-44832191 TCCGGGCTCTCTCCCTACAGGGG - Intergenic
929883785 2:45860707-45860729 TCTGGGGGCCCTGCCCACTTTGG + Intronic
936064457 2:109319910-109319932 TCTGGGGTCCCTCCTTGCAGGGG + Intronic
936155183 2:110042525-110042547 GCTGGGAGCGCTCCCCACAGAGG - Intergenic
937142128 2:119611022-119611044 TCTGGGGTCACTCACCTCCGGGG + Intronic
938082281 2:128376570-128376592 TCCTGGGTCCTTCCCCAAAGGGG - Intergenic
938733413 2:134164128-134164150 TCTAGGGTCCTTCCCCAAATTGG + Intronic
941890873 2:170579916-170579938 TCTGGGAACCCTGCCCAGAGAGG + Intronic
942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG + Intergenic
943226542 2:185185611-185185633 TCTGGGTCCCCTCTCCACTGAGG + Intergenic
943917750 2:193658970-193658992 TCTGGGCTCCCTCTCTGCAGTGG + Intergenic
948231897 2:236355062-236355084 TCTAGGCTCCCTCCCCACCCTGG + Intronic
948251318 2:236532148-236532170 TCTGGGGCTCCTTCCCACTGAGG + Intergenic
948306160 2:236948334-236948356 CATGGGGTCTCTCCACACAGTGG + Intergenic
948597925 2:239092373-239092395 TCTGGGTGCTGTCCCCACAGGGG - Intronic
1171865603 20:30485780-30485802 TCTCGGTGCCCTCCCCACTGGGG - Intergenic
1172275785 20:33678351-33678373 TCCCTGGTGCCTCCCCACAGGGG - Exonic
1172814857 20:37678352-37678374 TCTGGACTCCTGCCCCACAGGGG + Intergenic
1173280014 20:41618902-41618924 GCTGGGGTCCCGCGACACAGGGG + Intergenic
1173641924 20:44609468-44609490 ACTGCGGCTCCTCCCCACAGAGG + Intronic
1175291957 20:57881900-57881922 TCCGCTATCCCTCCCCACAGAGG + Intergenic
1175992395 20:62796357-62796379 TCTCGGGTCCCTTCCCGCCGGGG - Intergenic
1176108173 20:63399214-63399236 TGTGGGGTCCGTCCCGAGAGGGG + Intergenic
1176377350 21:6093089-6093111 TCTGGGGTCCTGCCTTACAGGGG + Intergenic
1179365359 21:40754115-40754137 TGTGCGGTTGCTCCCCACAGCGG - Intronic
1179521542 21:41948646-41948668 TCCATGGTCCTTCCCCACAGTGG + Intronic
1179746124 21:43445155-43445177 TCTGGGGTCCTGCCTTACAGGGG - Intergenic
1180082504 21:45493295-45493317 TCCCAGGTCCCTCCCAACAGTGG - Intronic
1180147746 21:45930626-45930648 CTAGGTGTCCCTCCCCACAGAGG + Intronic
1180312328 22:11250659-11250681 TCTCGGTGCCCTCCCCACTGGGG - Intergenic
1181607577 22:23989724-23989746 TCAAGGCTCCCTCCCCACTGGGG + Intergenic
1183462321 22:37959372-37959394 CCTGCGGTCGCTCCCCAGAGGGG - Exonic
1183782134 22:40005793-40005815 ACTGGGCTCCCTCCCTACACTGG - Intronic
1184830842 22:46985348-46985370 TCTGAGATTCTTCCCCACAGGGG - Intronic
1185061718 22:48610489-48610511 TCTGTGGTCCCTCACCACCCCGG - Intronic
1185388492 22:50547192-50547214 TCGGGGGTCCCTGCCCCCGGAGG + Intergenic
949808067 3:7977008-7977030 TCTGGGCTCCAACCCCACGGCGG - Intergenic
950475553 3:13212386-13212408 ACTGTGGTCTCTCCACACAGTGG - Intergenic
951680590 3:25290509-25290531 TCCTGTGTCCCTCCACACAGTGG - Intronic
952009039 3:28878276-28878298 TGTGGGGTCCTTCTACACAGAGG + Intergenic
952646210 3:35662478-35662500 TCTTGGGACCAACCCCACAGAGG + Intronic
952942178 3:38453774-38453796 TCTGGGGCCCCGCCCCTCAGGGG + Intergenic
953004017 3:38960727-38960749 TCTGGGGTCTCACCCCCCACAGG + Intergenic
956200773 3:66703186-66703208 TCTCAGGTCCCACCCCAGAGAGG - Intergenic
958819638 3:98958334-98958356 TCTGGGATCCTTCCCATCAGAGG + Intergenic
959242070 3:103808862-103808884 TCTGAGGGCACTCACCACAGTGG - Intergenic
961461844 3:127055526-127055548 TCGGGTCCCCCTCCCCACAGTGG - Intergenic
961787314 3:129355341-129355363 ACTGTGGTCTCTCCACACAGTGG + Intergenic
962350448 3:134651991-134652013 TCTGGGAGCCCTCCCCGCATTGG + Intronic
967493699 3:190120649-190120671 TCCGGGGGGCCGCCCCACAGTGG + Exonic
968131595 3:196195698-196195720 CCTGGAGTCCCAGCCCACAGGGG - Intergenic
968643104 4:1724704-1724726 TCTGGGGTCCCTTCCCACCCTGG - Intronic
968970597 4:3791575-3791597 TCTGGGGCCCCAACCCCCAGAGG - Intergenic
969326927 4:6449540-6449562 ACGGGAGTCCCTCCCGACAGGGG - Intronic
969755150 4:9144382-9144404 TCTGGGGTCCCTTTCCACACTGG + Intergenic
971508905 4:27399536-27399558 ACTGGGGACCTTCTCCACAGTGG + Intergenic
974145601 4:57943744-57943766 TCTGCCCTCCCTCCCCACACAGG + Intergenic
976299299 4:83502902-83502924 ACTGGTGTCCATCACCACAGTGG + Intronic
979275744 4:118812622-118812644 TCTGGAGTCCCACCACTCAGTGG - Intronic
981233494 4:142387576-142387598 TCTGGGTTCCCTTCCCTGAGTGG - Intronic
985578760 5:685745-685767 TCTGGTGGCCGTCCCCAGAGTGG - Intronic
986061062 5:4191813-4191835 TCTGGGCTCCCTCCTCAGAAAGG - Intergenic
986109178 5:4693961-4693983 TTTGAGGTCCCTTCCCAGAGAGG + Intergenic
986782921 5:11083846-11083868 TCTGGGGTGCCTGCCCCCATGGG - Intronic
998470848 5:142382620-142382642 TCTGGGCTCCCTCCCCATCTCGG - Intergenic
999247960 5:150165472-150165494 GATGGGGTCCCTCCGCACAAGGG - Intergenic
999772214 5:154784246-154784268 CCTGTGGTCCCTGCCCCCAGGGG + Intronic
1000432239 5:161165642-161165664 TCTGGGGTGCCCTTCCACAGTGG - Intergenic
1001542689 5:172550484-172550506 TCAGGAGGCCCTCCCCACAGAGG - Intergenic
1001988678 5:176097706-176097728 TCTGGTGTCCATCACCCCAGTGG + Intronic
1002075600 5:176706429-176706451 CCTGGCGTCCCGCCCCGCAGTGG - Intergenic
1002228190 5:177740430-177740452 TCTGGTGTCCATCACCCCAGTGG - Intronic
1002343338 5:178531328-178531350 CCTGGGTTCCCACCCCACACTGG - Intronic
1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG + Intronic
1002989144 6:2221865-2221887 TCTGTGGCCACTGCCCACAGGGG + Intronic
1003082927 6:3036956-3036978 TCTGGGATCTCTCCGTACAGGGG + Intergenic
1004459021 6:15818230-15818252 TCTGGCCTGCCACCCCACAGAGG + Intergenic
1006301242 6:33194496-33194518 TCTGGGGTCCCTTCCAACTTGGG + Exonic
1007501862 6:42304643-42304665 TCTGGGATCTCTCAGCACAGTGG - Intronic
1008376654 6:50799560-50799582 TCTGTGCTTCCTCCCCACAGAGG + Intergenic
1013317938 6:108959540-108959562 ACTGGGGGCTCTCCCAACAGTGG + Intronic
1013590934 6:111619203-111619225 ACTGGCCTACCTCCCCACAGAGG - Intergenic
1017095044 6:150797333-150797355 TCTGGGGTTACTCCTGACAGTGG - Intronic
1017644212 6:156524045-156524067 TCTGGGATCGCTCCTGACAGGGG + Intergenic
1018960098 6:168441659-168441681 TCTGGGGACCCTGCCCGCCGGGG + Intronic
1019033124 6:169030632-169030654 TCTGGGGTCCCCCACATCAGGGG + Intergenic
1019316936 7:391223-391245 GCTGGTGTCCCTGCCCAGAGTGG + Intergenic
1019440318 7:1042706-1042728 TCTGTGGGTCCTACCCACAGGGG - Intronic
1020745292 7:12072041-12072063 CCTGGGCTCCTTCCCCAAAGGGG - Intergenic
1025782217 7:64611860-64611882 TGTCTGGTCCCTGCCCACAGGGG + Intergenic
1026874475 7:73871494-73871516 TCTGGGGTCCCTCCAGCCACAGG - Intergenic
1026896688 7:74013593-74013615 GCTGGAGACCCTCCCCCCAGGGG + Intergenic
1026986353 7:74557352-74557374 TATGGTGTCCCTCCCCTCCGGGG + Intronic
1027174260 7:75893311-75893333 TCTGGGCTCCCTCCTTTCAGTGG - Intergenic
1029117964 7:98247521-98247543 CCAGGGGTCCTTCCCCAGAGTGG + Intronic
1029420087 7:100467776-100467798 TCTGGGCCCCCGCCCCACCGGGG - Intronic
1032512310 7:132481680-132481702 TGCTGGGTGCCTCCCCACAGAGG + Intronic
1033113682 7:138606330-138606352 TCTGGGTCCCCTCTCCACAGTGG - Intronic
1033270629 7:139930008-139930030 TCTGGAGGCCCTCCACACACAGG + Intronic
1037883895 8:22586235-22586257 TCTGGGGGCCTTCCGAACAGCGG + Intronic
1038931836 8:32202414-32202436 TTTGGGCTCCAGCCCCACAGTGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1045363500 8:101454357-101454379 CCTGGGGTAACTCCCCACACAGG - Intergenic
1046030108 8:108773644-108773666 TCTTGGGTCCCTCTCCTCAGGGG + Intronic
1046095726 8:109558171-109558193 TCTGAGGTCCCTCTTCCCAGGGG + Intronic
1047300136 8:123606942-123606964 TCTGGGACCACTTCCCACAGAGG + Intergenic
1047358397 8:124144844-124144866 CCTGAGGTCCCTTCCCTCAGGGG - Intergenic
1049342363 8:142120027-142120049 TCTGAAGTCCCTCCCCAGTGGGG - Intergenic
1049774024 8:144396471-144396493 TCTGCGGCCCCTCCCCTCACTGG - Exonic
1052903676 9:33816783-33816805 TCTCGGGGCCCTCCCCACTGTGG - Intergenic
1053114978 9:35491999-35492021 TCAGGAGCCCCTCCCCACACTGG - Intronic
1055644033 9:78346198-78346220 TCTGGAGTCCCTACCCTCACCGG + Intergenic
1057202966 9:93152875-93152897 ACTGGGGTGCATCCCAACAGTGG - Intergenic
1059402805 9:114081216-114081238 TCTGGGGTCCCTGCCCTCCTAGG + Intergenic
1060054178 9:120399681-120399703 ACTGGGGTCCAGCCCCACATTGG - Intronic
1060777210 9:126383769-126383791 ACTGTGGTCCCTCCTCACACAGG - Intronic
1061256951 9:129459037-129459059 TCATGGGGCCCTCCTCACAGTGG + Intergenic
1061714566 9:132510556-132510578 TGCGGGGTCCCTTGCCACAGTGG - Intronic
1061987217 9:134136539-134136561 TCTGGGGTCCTTCCCTGAAGGGG - Intronic
1062109322 9:134773390-134773412 TCTGGAGGCTCTTCCCACAGAGG - Intronic
1062510372 9:136902090-136902112 TCTGGCATCTCTGCCCACAGAGG - Intronic
1186223622 X:7375159-7375181 TCTGGGTTTCCTCTCCACTGAGG - Intergenic
1186414287 X:9369955-9369977 TCTGCGGTCCTTGCCCACAGAGG - Intergenic
1186606880 X:11101637-11101659 TCTTGCCTCCCTGCCCACAGTGG + Intergenic
1187002976 X:15201053-15201075 TCTGGGCTCCCTTCCCTCAACGG - Intergenic
1188390229 X:29610795-29610817 TTTGGGCTCCTGCCCCACAGTGG + Intronic
1189250706 X:39598985-39599007 CCTGGGCTCCATCCCCAGAGTGG + Intergenic
1190332917 X:49247050-49247072 TCTGGGTACCCATCCCACAGTGG - Intronic
1194994453 X:100576734-100576756 GCTGGGGTCCCACTCCACACAGG + Intergenic
1199380698 X:147168721-147168743 TTTGGGCTCCGGCCCCACAGTGG - Intergenic