ID: 1002440624

View in Genome Browser
Species Human (GRCh38)
Location 5:179262563-179262585
Sequence CAGCGTGACCAAGGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002440624_1002440629 -4 Left 1002440624 5:179262563-179262585 CCTTCTGCCCCTTGGTCACGCTG 0: 1
1: 0
2: 0
3: 26
4: 187
Right 1002440629 5:179262582-179262604 GCTGCGGTAACTCCAGCCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1002440624_1002440630 -3 Left 1002440624 5:179262563-179262585 CCTTCTGCCCCTTGGTCACGCTG 0: 1
1: 0
2: 0
3: 26
4: 187
Right 1002440630 5:179262583-179262605 CTGCGGTAACTCCAGCCTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 132
1002440624_1002440634 26 Left 1002440624 5:179262563-179262585 CCTTCTGCCCCTTGGTCACGCTG 0: 1
1: 0
2: 0
3: 26
4: 187
Right 1002440634 5:179262612-179262634 CATGTGCTGTTCCCTCTGCCTGG 0: 7
1: 76
2: 324
3: 914
4: 2143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002440624 Original CRISPR CAGCGTGACCAAGGGGCAGA AGG (reversed) Intronic
900462917 1:2809978-2810000 CACTGTGACCAAGGAGCAGTGGG - Intergenic
900937623 1:5776529-5776551 CAGCCAGACCAAGGGGCTGAAGG - Intergenic
901056356 1:6450282-6450304 CAGCCTGAGCCAGGGTCAGATGG + Intronic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902477990 1:16698203-16698225 CAGCCTGAGCCAGGGTCAGATGG - Intergenic
903885799 1:26540365-26540387 CTGTGTGACCAAGGGGCTTAAGG - Intronic
905104708 1:35557498-35557520 CCGCGAGACCAAGGGGGAGGAGG + Intronic
906798550 1:48716582-48716604 CATCGTGCCCATGGGGCTGAAGG + Intronic
906850854 1:49249001-49249023 CATCCTGACCAAGGGGCTCATGG + Intronic
906975792 1:50571386-50571408 CTGTGTGACCATGGGGCAAATGG + Intronic
910154157 1:84194117-84194139 CTGCTTGAACAAGGGGCAGTAGG - Intronic
911224407 1:95289362-95289384 CATCGTGACCAAGGGCAAAATGG - Intergenic
913349016 1:117837578-117837600 CAGAGTGATCTAGGGGCAGAAGG - Intergenic
915524935 1:156469973-156469995 CCTCATGCCCAAGGGGCAGAGGG + Intronic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
920682660 1:208084604-208084626 CAGCATGAACAGGGGACAGATGG - Intronic
924612693 1:245587121-245587143 CAGCATGGCCAAGGTGCAGGGGG - Intronic
1063403848 10:5774286-5774308 AAGAATGACCAAGGGGCATAAGG - Intronic
1063814933 10:9760593-9760615 TAGTGGGAGCAAGGGGCAGAGGG + Intergenic
1065944399 10:30593699-30593721 CAGAGTGACCAAGGAGCAGGAGG - Intergenic
1067174066 10:43930280-43930302 CAGGGTTACCTAGGGGGAGATGG + Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1067560096 10:47299519-47299541 CAGCTTAACCCTGGGGCAGAAGG - Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1076884490 10:133255538-133255560 CGGCGGGACCGCGGGGCAGAGGG - Intergenic
1077350300 11:2090187-2090209 CAGCATCAACAAGGGGCAGAGGG - Intergenic
1077478719 11:2803110-2803132 CAGAGTGAGCAAGGGGCTCAGGG + Intronic
1077776991 11:5282865-5282887 CAGCTTGACCAAGGGGTCAAAGG + Intronic
1079145508 11:17847670-17847692 CAGGGGGAGCAAGGGACAGAAGG + Intronic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1080561493 11:33467414-33467436 GAGAGTGACCATTGGGCAGATGG + Intergenic
1081671662 11:44945891-44945913 CATCCTGCCCAAGGGGCCGACGG - Intronic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083600231 11:63942769-63942791 CTGCCTGCCCATGGGGCAGAAGG - Intronic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1085444151 11:76589571-76589593 CAGCGTGACAAAGGTGGACAAGG + Intergenic
1088044297 11:105428840-105428862 CTGAGTGAAGAAGGGGCAGATGG - Intergenic
1089074175 11:115724778-115724800 CAGCATGGCCAAGGGGAAGATGG - Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1102747785 12:115265091-115265113 GAGCATGACCAATGGGTAGATGG + Intergenic
1102953760 12:117046558-117046580 CAGCGTGTGCATGGGGCAGATGG - Exonic
1103945798 12:124525702-124525724 CGGCGTACCCACGGGGCAGAGGG + Intronic
1104751990 12:131245699-131245721 CAGCGTGGCCTATGGCCAGACGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1107015630 13:35706197-35706219 CAGGGTGAGCTAGGTGCAGAAGG + Intergenic
1108129011 13:47276917-47276939 GAGCGGGAGCAAGAGGCAGAGGG + Intergenic
1113480394 13:110615951-110615973 CGGGGTGACAGAGGGGCAGAGGG + Intronic
1113495769 13:110727747-110727769 CACCGTGGCCAAGGGGTAGATGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1116064947 14:39970802-39970824 CAATTTGACCAAGGGGCATAAGG - Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121924310 14:97914145-97914167 GAGCTTGACCAAAGGACAGAGGG - Intergenic
1122068430 14:99189708-99189730 CATCCACACCAAGGGGCAGAAGG + Intronic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1129153368 15:73702917-73702939 CAACGTGACCACGTCGCAGATGG + Exonic
1129153681 15:73704321-73704343 CAACGTGACCACGTCGCAGATGG + Exonic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129256049 15:74334769-74334791 CAGCCTGACCAAGACACAGATGG - Intronic
1129565912 15:76623529-76623551 CAGCTTTACCAAGGATCAGATGG + Intronic
1129717499 15:77860688-77860710 CAGAGTGGCCCAGGGGCAGCAGG - Intergenic
1130461253 15:84159509-84159531 CAGAGTGGCCCAGGGGCAGCAGG + Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1131513861 15:93064825-93064847 CATGGTGAGCAAGAGGCAGAGGG + Intronic
1133717027 16:8459595-8459617 CAGAGTTTCCAAGGGGGAGATGG - Intergenic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1137444201 16:48522046-48522068 CAGCTTTACCCAGGGGCAGATGG + Intergenic
1141093780 16:81148413-81148435 CAGCTTCCACAAGGGGCAGAAGG - Intergenic
1141150098 16:81558602-81558624 TGGAGTGAGCAAGGGGCAGAAGG + Intronic
1141612805 16:85192699-85192721 CAGCTTCAGCAAGTGGCAGAGGG + Intergenic
1141623576 16:85249776-85249798 CTGCGTGCCCAAGTGGCACAGGG + Intergenic
1141760782 16:86027115-86027137 CAGCGTCACCAAGGGGCCTGGGG - Intergenic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143026990 17:3946839-3946861 CAGCAGGCCCATGGGGCAGAAGG - Intronic
1144697447 17:17314618-17314640 CAGCCTGGCCAAGGGACAGCGGG - Intronic
1144878747 17:18419653-18419675 CATCCTGACCAAGGGGCACTGGG + Intergenic
1145153490 17:20524742-20524764 CATCCTGACCAAGGGGCACTGGG - Intergenic
1145159265 17:20563540-20563562 CATCCTGACCAAGGGGCACTGGG - Intergenic
1148669771 17:49402037-49402059 CAGCCCGACCAAAGGGGAGAGGG + Intronic
1150213042 17:63452059-63452081 CAGCATGAAGAAGAGGCAGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150325766 17:64256135-64256157 TAGCGTAACCATAGGGCAGAAGG - Intronic
1151546750 17:74797940-74797962 CAGAATGACCAGGGGGCAGCGGG - Intronic
1151679454 17:75615849-75615871 CAGCGTGACCTGGGATCAGAGGG + Intergenic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1155299858 18:24419280-24419302 CAGCATCAACAAGGGGGAGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1162373594 19:10292646-10292668 CAGCGTCTCCGAGGGGCAGATGG + Exonic
1165257993 19:34591644-34591666 CAGCTGGAACAAGGGGCAGCAGG - Intergenic
1166213505 19:41321750-41321772 CAGCAGCACCAAGGGGCAGAAGG + Intronic
1202712010 1_KI270714v1_random:24030-24052 CAGCCTGAGCCAGGGTCAGATGG - Intergenic
924980062 2:211187-211209 CAGAGTGCCCGAGGGGCTGATGG - Intergenic
925021814 2:575578-575600 CAGGGTGTGCAAGGGCCAGAAGG + Intergenic
925893772 2:8456420-8456442 CAGCCTCACCAAGCGGGAGAGGG + Intergenic
929426782 2:41851851-41851873 GTGGGTGAGCAAGGGGCAGAGGG + Intergenic
931288212 2:60850156-60850178 CAGAGTACCCAAGGGGCAGCTGG - Intergenic
934754694 2:96816849-96816871 CAGCGCGCCCAAGGCGCAGCCGG - Exonic
934790471 2:97055593-97055615 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
934815998 2:97326939-97326961 CATCGTGTCCAGGGGGCAGTGGG + Intergenic
934821698 2:97381545-97381567 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
935320547 2:101884033-101884055 CAGGGGGAGCAAGAGGCAGACGG + Intronic
935351629 2:102155798-102155820 CAGTGTGCTCAAGGGGCACAAGG - Intronic
940192303 2:151054897-151054919 CAGAGTGAGCAAGGGGCATGAGG - Intergenic
943721411 2:191206834-191206856 CAGCGAGGTCAAGTGGCAGAAGG - Intergenic
948813930 2:240500088-240500110 CAGCGTGTGGAAGGGGCAGCGGG + Exonic
1169072173 20:2739306-2739328 CAGCTCCACCACGGGGCAGACGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1172905604 20:38366911-38366933 CAGCTTGACCAAGAGTGAGAAGG + Intronic
1173789486 20:45818513-45818535 CACCGTGACCAAGGACCACATGG - Intergenic
1173838737 20:46142453-46142475 CAGAGTGAGCAAGGGAGAGAGGG - Intergenic
1174186244 20:48708310-48708332 CAATGAGACCAAGCGGCAGATGG - Exonic
1174534578 20:51241024-51241046 CACAGTGACCAAGAGGCAGGTGG - Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175642483 20:60642670-60642692 CAGGCTGACCAAGGGGCTGTGGG - Intergenic
1176039042 20:63054839-63054861 CAGCCTGGTCAAGGGGCACAGGG + Intergenic
1179894227 21:44352306-44352328 GAGTGTGGCCAAGGGGCAAAGGG + Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183278145 22:36914243-36914265 CAGAGAGACTAAGAGGCAGAGGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184902110 22:47452888-47452910 CAGCATGCCGAAGGGGCTGAAGG - Intergenic
949371889 3:3344170-3344192 CAGGATGAGCAAGGGGTAGAGGG - Intergenic
951391204 3:22106356-22106378 AACAGTGACCAAAGGGCAGATGG - Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954898909 3:54002124-54002146 CAGCGTTTCCAAGGTGAAGAAGG + Intergenic
963073421 3:141323993-141324015 CAGAGCTACCAAGAGGCAGATGG - Intergenic
966155332 3:176910190-176910212 CAGTGTGACCAAGAGGGAGCAGG - Intergenic
968010448 3:195270890-195270912 CAGCGCCACCAAGAGGCTGAAGG - Exonic
968054264 3:195679187-195679209 CAGCGTGACTAAGGCACAGAAGG + Intergenic
968101623 3:195969959-195969981 CAGCGTGACTAAGGCACAGAAGG - Intergenic
971317081 4:25576581-25576603 CAGTGTGACAATGGGGCGGAAGG - Intergenic
972387895 4:38585550-38585572 CAGTGTGACCAAGGCACAGTGGG - Intergenic
973537757 4:51901144-51901166 CTGAGTGACCCAGGGGCTGAAGG - Intronic
974805385 4:66873070-66873092 GAGCATGACAAAGGGGCACAAGG + Intergenic
976798175 4:88958048-88958070 CAGCCTGGCCAAGCGTCAGAGGG + Intronic
981240062 4:142466560-142466582 CAGCCTGACCATGTGGCAGAGGG + Intronic
983067423 4:163227490-163227512 GAATTTGACCAAGGGGCAGAAGG - Intergenic
984752840 4:183295528-183295550 CAGCGTCACCAAGGCACAGCTGG - Intronic
985120416 4:186635194-186635216 TAGCATGACTAAGGGGCAGAAGG + Intronic
985500567 5:241849-241871 CAGTGTGACTAAGGCACAGAAGG + Intronic
985670372 5:1203692-1203714 CAGCATGACCAAAAGGCACAGGG - Intronic
985736824 5:1587859-1587881 CAGCATGACTAAGGCACAGAAGG - Intergenic
986704160 5:10441640-10441662 CAGCCAGAGCAAGGGGAAGAGGG + Exonic
990982595 5:61615413-61615435 CTGCCTTACCAGGGGGCAGAGGG - Intergenic
992001852 5:72443931-72443953 AAGGGTGACCTTGGGGCAGAGGG - Exonic
995520183 5:112996197-112996219 CAGCACCACCAAGTGGCAGAAGG - Intronic
996917250 5:128726479-128726501 ATGCGTGACCATGGGACAGAAGG - Intronic
1002334174 5:178466662-178466684 CAGCATGGCCAAGGGGCTGCAGG - Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002646341 5:180658450-180658472 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646347 5:180658474-180658496 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646355 5:180658506-180658528 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646361 5:180658530-180658552 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646371 5:180658570-180658592 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646381 5:180658610-180658632 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646395 5:180658666-180658688 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646401 5:180658690-180658712 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646407 5:180658714-180658736 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1002646423 5:180658778-180658800 CAGCGGGACAGAGGGACAGAGGG + Intergenic
1005158317 6:22833880-22833902 CAATGTGGCCAAGGGGCATAAGG - Intergenic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1007415578 6:41689433-41689455 CAGGTTGGCGAAGGGGCAGAGGG - Intronic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1018174655 6:161168168-161168190 CAGCCTGACAAAGGGACAGAGGG + Intronic
1018228907 6:161656720-161656742 GAGAGTGACCAAGGGGCCAAGGG - Intronic
1018831398 6:167446427-167446449 CAGGGTGTCCTAGGGGCAGTGGG - Intergenic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1022801337 7:33780142-33780164 CAGGGTGACCAAGAAGCAGGTGG - Intergenic
1023849428 7:44141798-44141820 CCCTCTGACCAAGGGGCAGAAGG + Intergenic
1027736193 7:81935900-81935922 CAGAGGGACAAAGGGACAGAAGG - Intergenic
1029043382 7:97600911-97600933 CAAGGTGAGCAAGGGGAAGAAGG + Intergenic
1029484134 7:100828929-100828951 CAGCCCCTCCAAGGGGCAGAAGG + Intronic
1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG + Intronic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1041441826 8:57905181-57905203 CATCATAACCAAGGGGAAGAAGG + Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1049684543 8:143934051-143934073 CATCGTGACCAAGCTGCAGATGG - Exonic
1049755530 8:144309813-144309835 CAGCGTCACCAAGCTGCTGACGG + Exonic
1050992428 9:12170965-12170987 CAGCTAGACCAAGTGGCACATGG - Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1058061737 9:100504397-100504419 CAGTGTCACCAAGTGACAGATGG + Intronic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060553371 9:124496074-124496096 CTGCTTGGCCAAGGGGCAGGTGG - Intronic
1061408089 9:130403608-130403630 CAGAATGACCAAGGGACAGAAGG - Intronic
1062152679 9:135030070-135030092 GTGGGTGACCAAGGGGCAGGTGG - Intergenic
1203794706 EBV:170091-170113 AAGCGTGACCAAGGGGCCCGTGG + Intergenic
1203794907 EBV:170629-170651 AAGCGTGACCAAGGGGCCCGTGG + Intergenic
1203795098 EBV:171152-171174 AAGCGTGACCAAGGGGCCCGTGG + Intergenic
1203795299 EBV:171690-171712 AAGCGTGACCAAGGGGCCCGTGG + Intergenic
1189986023 X:46553904-46553926 GAACTTGGCCAAGGGGCAGAAGG + Intergenic
1190305675 X:49080163-49080185 GTGGGTGACCAAGGGGCTGAGGG - Intronic
1190394346 X:49965155-49965177 CAGAGTAACAAAGGGGCTGAAGG + Intronic
1192180648 X:68913690-68913712 CAGAGAGGCCGAGGGGCAGAAGG + Intergenic
1192362555 X:70448843-70448865 CAGGTTGACTAAGGGGCAGATGG + Intronic
1192803525 X:74490657-74490679 CTGCGTGACCAAGGGCCTCATGG - Intronic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1199347107 X:146754476-146754498 CAGCGTGCCTAAGGGGCTGAGGG + Intergenic
1202378003 Y:24255635-24255657 CAGAGTGGCCCAGGGGCAGCAGG - Intergenic
1202492779 Y:25414486-25414508 CAGAGTGGCCCAGGGGCAGCAGG + Intergenic