ID: 1002440846

View in Genome Browser
Species Human (GRCh38)
Location 5:179263576-179263598
Sequence GCGTGAGCTGCGCTCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002440841_1002440846 6 Left 1002440841 5:179263547-179263569 CCGACAGTTTGGGATGGGAGGCG 0: 1
1: 0
2: 0
3: 30
4: 446
Right 1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 162
1002440835_1002440846 29 Left 1002440835 5:179263524-179263546 CCTGCAGGCTCTCTCTGGGTGTG 0: 1
1: 0
2: 1
3: 31
4: 262
Right 1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG 0: 1
1: 0
2: 2
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002440846 Original CRISPR GCGTGAGCTGCGCTCCTGGC CGG Intronic
900244927 1:1632354-1632376 ACCTGCGCTGCGCTCCAGGCCGG - Exonic
900428665 1:2592037-2592059 GCCTGAGCTCAGCTCCTGTCTGG - Intronic
900645907 1:3708689-3708711 GCGTGCCCTCCACTCCTGGCTGG - Intronic
900884532 1:5405123-5405145 GTGTGAGGTGGGCTCCTGGGGGG - Intergenic
900885943 1:5415501-5415523 TTGTGTGCTGGGCTCCTGGCTGG - Intergenic
901065029 1:6490407-6490429 GTGGGAGCTGCGCTCCGGACGGG - Intronic
901129079 1:6950922-6950944 GCCTGAGCTGGGCTCCTGCAGGG + Intronic
905208114 1:36354580-36354602 GCGTGACCTGCGCGTCTGGATGG + Intronic
905889627 1:41511035-41511057 GGGTGGGGTGGGCTCCTGGCCGG + Exonic
912277314 1:108273080-108273102 GCGAGTGCTGCGGTGCTGGCTGG + Intergenic
912290914 1:108421276-108421298 GCGAGTGCTGCGGTGCTGGCTGG - Intronic
915340540 1:155174594-155174616 GTGTCAGCTGCGCCCCTGACCGG + Intronic
916660902 1:166921493-166921515 GCCTCAGCTCCGCTCCAGGCTGG + Intronic
918070706 1:181131714-181131736 GGGTGAGCTCAGCACCTGGCGGG - Intergenic
919466506 1:197926664-197926686 ATGTGAGCTGTGCCCCTGGCTGG - Intronic
922831744 1:228557740-228557762 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922832224 1:228609722-228609744 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922832784 1:228611963-228611985 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922833345 1:228614204-228614226 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922833905 1:228616445-228616467 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922834462 1:228618686-228618708 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922835573 1:228623121-228623143 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922836131 1:228625363-228625385 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922836689 1:228627602-228627624 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922837248 1:228629844-228629866 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922837809 1:228632085-228632107 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922838367 1:228634325-228634347 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922838925 1:228636550-228636572 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922839485 1:228638791-228638813 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922840046 1:228641022-228641044 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922840606 1:228643263-228643285 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
922841169 1:228645494-228645516 GCTGGAGCCGGGCTCCTGGCGGG + Intergenic
1071465455 10:85935562-85935584 GGCTGAGCTGTGGTCCTGGCTGG - Intronic
1073110953 10:101062741-101062763 GCGAGGGCTGCGCTCCCTGCCGG + Exonic
1073218718 10:101851945-101851967 ACGTGGGCTGCACTCGTGGCTGG + Intronic
1075064865 10:119282554-119282576 GCGTGTGCTGCGGCCCTGGATGG + Intronic
1075724443 10:124604286-124604308 GCCTGAGCTGGGTCCCTGGCAGG - Intronic
1076348113 10:129794672-129794694 GGGAGAGCCGCGTTCCTGGCTGG + Intergenic
1076873274 10:133203925-133203947 GCGTGAGCTGCACTCCAGCCAGG + Intronic
1076908996 10:133378194-133378216 CCGCGAGCTGAGCTCCAGGCAGG - Intergenic
1077240189 11:1506754-1506776 GCTTGTGCTGCGCTCTGGGCCGG - Intergenic
1078733070 11:13993485-13993507 GAGTGAGCTGGGCAGCTGGCTGG - Intronic
1083378102 11:62242592-62242614 GCCTGAGCTTCACTCCTGGGTGG + Intronic
1083472069 11:62890703-62890725 GCGTGAGCCACGTGCCTGGCTGG + Intergenic
1083667997 11:64285712-64285734 GCGCGAGCTGCGCCGCTGGCGGG - Intronic
1086167358 11:83795123-83795145 GCGTGAGCACCGCGCCTGGCCGG - Intronic
1092192706 12:6532599-6532621 GCGTGAGCTATGCTGCAGGCGGG + Intergenic
1094107880 12:26832997-26833019 GCCTGGGCTGCGCTCTTCGCGGG - Exonic
1096780001 12:53986147-53986169 GCGTCCGCTGAGCTCCAGGCTGG + Intronic
1101883445 12:108641564-108641586 GCCTGAGCACCTCTCCTGGCTGG + Intergenic
1103270497 12:119669239-119669261 GCGTGAGCTACGGTGCTGGCCGG + Intronic
1104376267 12:128267349-128267371 GCGGGCGCTGCGCTTCGGGCTGG + Intergenic
1106131602 13:26944256-26944278 GAGTGAGCTGACCTCCAGGCTGG + Intergenic
1111503950 13:89162035-89162057 GCGCGAGCTATGCGCCTGGCGGG + Intergenic
1112283123 13:98080091-98080113 GCGTGAGCCATGCGCCTGGCCGG + Intergenic
1113947297 13:114051386-114051408 GCGTGAGGTCTGCTCCTGACGGG + Intronic
1115502253 14:34060273-34060295 ACGTGAGCTGCGAGCCTGCCGGG - Intronic
1118561339 14:67086756-67086778 GCGTGAGCCACGCGCCTGGCCGG - Intronic
1119748785 14:77063295-77063317 GCGTGTGCTCAGCTACTGGCAGG - Intergenic
1121234647 14:92383415-92383437 GCATGTGCTGCGCCCCTGCCTGG + Intronic
1122096615 14:99376997-99377019 GCGTGGGCTGCCTTCCAGGCTGG - Intergenic
1123680791 15:22761985-22762007 ACCTGAGCTGTGTTCCTGGCTGG + Intergenic
1124272447 15:28295236-28295258 ACCTGAGCTGTGTTCCTGGCTGG - Intronic
1124332999 15:28836443-28836465 ACCTGAGCTGTGTTCCTGGCTGG + Intergenic
1125506305 15:40269736-40269758 GCTTGTGCTGGGCTCCTGGCTGG + Intronic
1125728893 15:41882088-41882110 GCGCGAGCGGCGATCCTCGCTGG - Exonic
1128089790 15:64911790-64911812 GGGGCAGCTGCGCTCCTAGCAGG + Intronic
1129438682 15:75562747-75562769 GCGTGAACTGCACTCCAGCCTGG + Intronic
1131828896 15:96341889-96341911 GCGTGGACTGTGCCCCTGGCAGG + Intergenic
1132746238 16:1437541-1437563 CCGTGAGCTGCCCGCATGGCCGG + Intronic
1132799166 16:1743202-1743224 GCTCGAGCTGGGCTGCTGGCTGG + Intronic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1133282102 16:4672473-4672495 GCGGGAGCGGAGCACCTGGCCGG + Intronic
1134823591 16:17266632-17266654 GTGTGAGCAGTGCACCTGGCTGG - Intronic
1136175241 16:28512153-28512175 GAGAGAGCTGCGCTCCAGACTGG - Intergenic
1136414718 16:30096144-30096166 GAGTGGGGGGCGCTCCTGGCGGG + Exonic
1142419722 16:89962933-89962955 ACGGGAGCTGCAGTCCTGGCAGG + Intronic
1145764557 17:27449408-27449430 GCGTGAGCCGTGCACCTGGCTGG + Intergenic
1146010417 17:29190076-29190098 TGGGGAGCTGGGCTCCTGGCTGG - Intergenic
1148496264 17:48055023-48055045 GTGAGAGCTGCGGTCCAGGCGGG - Intronic
1150642449 17:66958699-66958721 GAGTGAGCTGGGCTGATGGCAGG - Intergenic
1150752858 17:67882113-67882135 GCGTGAGCTACCGTGCTGGCCGG + Intronic
1151909543 17:77073008-77073030 GCGTGAGCCACGCACCTGGCTGG - Intergenic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1155654413 18:28177385-28177407 GCTTCCGCTGCGCTCCGGGCCGG - Exonic
1156702411 18:39841536-39841558 GTCTGAGCTGCGCTCCGGGGAGG + Intergenic
1160213747 18:76907607-76907629 GTGTGAGCTGCGCGCCTGGCCGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161621271 19:5298614-5298636 GGGTGAGGCGGGCTCCTGGCTGG - Intronic
1161961299 19:7524878-7524900 GCGTGTGCTGCCTTCCTGGTTGG + Intronic
1163085245 19:14974893-14974915 CAGTGAGCTGCACTCCTGCCTGG - Intronic
1163585172 19:18160017-18160039 GCTTGAGCCGCCATCCTGGCCGG + Intronic
1165072501 19:33263704-33263726 GCCTGGCCTGAGCTCCTGGCAGG + Intergenic
1165996336 19:39846445-39846467 GCGTGCGCCGAGCTCCGGGCGGG - Intergenic
1166278200 19:41770363-41770385 CAGTGAGCTGCGCTCCAGCCTGG + Intronic
1167959227 19:53092592-53092614 GCGTGAGCTACCATGCTGGCTGG + Intronic
926145476 2:10394619-10394641 ACGTGAGCTGCGGACCTGGGGGG + Intronic
931395988 2:61888727-61888749 GCGTGCGGTGGGCTCCGGGCTGG + Exonic
936067270 2:109342148-109342170 GCATGGGCTGAGCCCCTGGCTGG + Intronic
937145350 2:119639402-119639424 GCGTGTGCAGCTCTCCTGCCTGG + Intronic
937157501 2:119731430-119731452 GCATGAGCCACGCGCCTGGCTGG - Intergenic
937427119 2:121809325-121809347 GCGTGAGCACCGCGCCTGGCCGG + Intergenic
938073261 2:128319138-128319160 GCGTGGGAGGCTCTCCTGGCGGG + Intergenic
941699786 2:168592335-168592357 GCCTGAGCTGCCCCACTGGCTGG + Intronic
948659673 2:239499234-239499256 GGGTGAGCTGCTGGCCTGGCCGG + Intergenic
948674056 2:239586893-239586915 ACGTCAGCTGCCCTCTTGGCAGG - Intergenic
1171012188 20:21514858-21514880 GAGAGAGCTCCGCTCCGGGCCGG + Intergenic
1171355606 20:24543385-24543407 GGGCGTGCTGCGCTCCTGGGGGG + Exonic
1171374832 20:24685396-24685418 GCCTGCGCTGCCCACCTGGCAGG - Intergenic
1171452939 20:25248517-25248539 GCGTTACCTGCGCCCCTAGCCGG + Intronic
1172602757 20:36195226-36195248 GCGTGCTCTGGGCTCCTTGCTGG + Intronic
1173655975 20:44700629-44700651 ACGTGAGATGCGACCCTGGCTGG - Intergenic
1178916667 21:36708899-36708921 GCGGGAGCTGTGGGCCTGGCAGG + Intronic
1180036578 21:45253401-45253423 GCCTGTGCTGATCTCCTGGCTGG + Intergenic
1180597989 22:16991793-16991815 GCTAGAGCTGCCCTCCTTGCTGG + Intronic
1180650053 22:17369816-17369838 GGGCGAGCTCCGCTCCTGGTGGG + Exonic
1180843587 22:18970315-18970337 GCGTGAGCGGCGCGGCTGGCCGG - Intergenic
1181672603 22:24432725-24432747 GGGTGAGCTGGAGTCCTGGCAGG + Exonic
1181758012 22:25039083-25039105 GCCTGAGATGGGCTCTTGGCTGG + Exonic
1182605129 22:31496924-31496946 GCGTCTAGTGCGCTCCTGGCCGG + Intronic
1184577774 22:45387165-45387187 GCGTGAGCATCACGCCTGGCTGG - Intronic
1184753601 22:46503244-46503266 GGGTCTGCTGCCCTCCTGGCTGG - Intronic
1185121469 22:48974199-48974221 GGGTGAGCTGCCCACCTGGCTGG + Intergenic
954083062 3:48223789-48223811 GGGGGAGATGCCCTCCTGGCAGG - Intronic
959636421 3:108577616-108577638 GCATGAGCTGCTGGCCTGGCCGG - Intronic
960882922 3:122364103-122364125 GCCTGAACTGCGCTCCTGGTTGG - Intronic
962310836 3:134325901-134325923 GCGTGAGCTGGAGGCCTGGCAGG - Intergenic
962498384 3:135965625-135965647 GCGTGGGCGGGGCTCCGGGCGGG + Intergenic
967781069 3:193440210-193440232 GCTTGAGCTCAGCTCCTGGAGGG - Intronic
967853791 3:194101351-194101373 GCATGAACTGCTCTCCTGGTTGG - Intergenic
968605685 4:1534271-1534293 GCTTGGGCCGTGCTCCTGGCTGG + Intergenic
968775415 4:2536910-2536932 GCGTCGGCTGGGCTCATGGCGGG - Intronic
974055392 4:56978218-56978240 GCGTGAGCCACGCGCCCGGCCGG - Exonic
976199908 4:82567723-82567745 GAGTGAGCTGCACTCCAGCCTGG - Intergenic
982068625 4:151675665-151675687 CTGGGAGCTGCGCTCCTGGCTGG - Intronic
985119667 4:186627500-186627522 GCTGGAGCTGCGGTCCTGGACGG - Intronic
985703963 5:1390080-1390102 CCGTGAGCTGCGGCACTGGCTGG - Intergenic
986391783 5:7293956-7293978 ACCTGAGCTGTGTTCCTGGCTGG + Intergenic
990718517 5:58666703-58666725 GCCTGAGCTGCGGTCAGGGCAGG + Intronic
994020831 5:95023481-95023503 GTTTGAGCTGCGCTCCTGGGAGG + Intronic
994407467 5:99363184-99363206 GAGTGAGTGGAGCTCCTGGCTGG - Intergenic
995678882 5:114695503-114695525 GCCTGAGTTGAGCTCCTGGTGGG + Intergenic
1001928718 5:175658076-175658098 GCGCCGGCTGCGCTCCGGGCAGG - Exonic
1002141596 5:177144281-177144303 GCCTGATCTTGGCTCCTGGCTGG + Intronic
1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG + Intronic
1003860364 6:10317229-10317251 GCGTGAGCCACCCACCTGGCCGG + Intergenic
1005838283 6:29723938-29723960 TCGTGACCTGCGCCCCCGGCCGG - Intronic
1005859187 6:29888235-29888257 TCGTGACCTGCGCCCCGGGCCGG - Intergenic
1005931780 6:30490006-30490028 TCGTGACCTGCTCCCCTGGCCGG - Intronic
1006043189 6:31271566-31271588 TCGTGACCTGCGCCCCGGGCCGG + Intronic
1006052777 6:31356655-31356677 TCGTGACCTGCGCCCCGGGCCGG + Intronic
1011653768 6:89531166-89531188 GCGGAAGGTGCGCTCCTGTCTGG + Intronic
1018399843 6:163411824-163411846 GCGTGAGCCACGTGCCTGGCAGG - Intergenic
1018810962 6:167297949-167297971 ACGTGAGCTGCTCTTCTGGAAGG - Exonic
1019338281 7:495233-495255 GAGTGAGCTGTGCCCCTGGCAGG - Intergenic
1019589098 7:1820484-1820506 GTGTGAGCCCTGCTCCTGGCCGG - Intronic
1019940430 7:4284904-4284926 GTGTGATCTGAGCTCCTTGCAGG - Intergenic
1020012726 7:4815477-4815499 GCCTGGGCTGCCCTCCTGGGGGG + Intronic
1020030491 7:4929411-4929433 GCGTGTTCTGGGCTCCTGGGGGG - Intronic
1022469790 7:30675114-30675136 GCCCCAGCTGCTCTCCTGGCAGG + Intronic
1026829261 7:73601071-73601093 ACTTGAGCAGCTCTCCTGGCAGG - Intronic
1026973266 7:74480610-74480632 GCCTGAGCCTGGCTCCTGGCAGG - Intronic
1026981263 7:74528095-74528117 GCTTGAGATTAGCTCCTGGCAGG - Intronic
1029834770 7:103297557-103297579 GGGTGAGCTTCCCTCCAGGCCGG + Exonic
1032192849 7:129774382-129774404 GCGTGTGCTGGGAGCCTGGCTGG + Intergenic
1033476229 7:141695984-141696006 GCATGAGCTCAGCACCTGGCAGG - Intronic
1034893806 7:154862398-154862420 GCGTGAGCAGCTGTCCTGGTGGG + Intronic
1039883983 8:41645310-41645332 GGGTGATCTGAGCTGCTGGCAGG - Exonic
1042253013 8:66775200-66775222 GCGCCAGCTGCGCTCCCTGCGGG - Exonic
1046872123 8:119215298-119215320 GAGTGAGCTGGGCTCCAGACCGG + Intronic
1048370439 8:133772024-133772046 GTGTGAGCTCAGCTCCTGGCTGG + Intergenic
1049477320 8:142802775-142802797 GGGTGGGCTGTGTTCCTGGCTGG + Intergenic
1053519744 9:38765549-38765571 GCGTGAGCCCCGCGCCTGGCCGG - Intergenic
1055603919 9:77948540-77948562 GCCTAGGCTGCCCTCCTGGCTGG - Intronic
1057097422 9:92325061-92325083 GCGAGAGCTGAGCGCCTGCCGGG - Exonic
1057222625 9:93265482-93265504 GCGTGAGCTGCGCTTTGGTCAGG + Intronic
1060659735 9:125397790-125397812 GCCAGAGCTGCGCTCCTGGCCGG - Intergenic
1062093579 9:134691134-134691156 GCTTGAGCGCTGCTCCTGGCTGG - Intronic
1185461441 X:334459-334481 GAGTGCGCTGCGCTCCCCGCTGG - Exonic
1192147806 X:68693677-68693699 GCGGCAGCTGCTCTTCTGGCTGG + Intronic
1195418596 X:104647553-104647575 GAGAGAGCTGCTCTCCAGGCAGG - Intronic
1196444538 X:115738633-115738655 GCGGGTGCCGCGCTGCTGGCCGG + Intergenic