ID: 1002441167

View in Genome Browser
Species Human (GRCh38)
Location 5:179265284-179265306
Sequence GTTCAGGGGTGGAGCCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002441167_1002441173 -7 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441173 5:179265300-179265322 CCTGAACCAGAAACCATGTCGGG 0: 1
1: 0
2: 1
3: 7
4: 140
1002441167_1002441182 10 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441182 5:179265317-179265339 GTCGGGAGGGGAGAGGTGGCGGG 0: 1
1: 2
2: 3
3: 114
4: 1323
1002441167_1002441184 12 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441184 5:179265319-179265341 CGGGAGGGGAGAGGTGGCGGGGG 0: 1
1: 0
2: 7
3: 145
4: 1747
1002441167_1002441180 6 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441180 5:179265313-179265335 CCATGTCGGGAGGGGAGAGGTGG No data
1002441167_1002441183 11 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441183 5:179265318-179265340 TCGGGAGGGGAGAGGTGGCGGGG No data
1002441167_1002441185 16 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441185 5:179265323-179265345 AGGGGAGAGGTGGCGGGGGAAGG 0: 1
1: 1
2: 28
3: 361
4: 3316
1002441167_1002441171 -8 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441171 5:179265299-179265321 CCCTGAACCAGAAACCATGTCGG No data
1002441167_1002441175 -3 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441175 5:179265304-179265326 AACCAGAAACCATGTCGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 97
1002441167_1002441186 17 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441186 5:179265324-179265346 GGGGAGAGGTGGCGGGGGAAGGG 0: 1
1: 1
2: 20
3: 268
4: 2635
1002441167_1002441176 -2 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441176 5:179265305-179265327 ACCAGAAACCATGTCGGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 117
1002441167_1002441174 -4 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441174 5:179265303-179265325 GAACCAGAAACCATGTCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 81
1002441167_1002441178 3 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441178 5:179265310-179265332 AAACCATGTCGGGAGGGGAGAGG No data
1002441167_1002441181 9 Left 1002441167 5:179265284-179265306 CCTGGTCGGCTCCACCCCTGAAC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1002441181 5:179265316-179265338 TGTCGGGAGGGGAGAGGTGGCGG 0: 1
1: 0
2: 5
3: 75
4: 1338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002441167 Original CRISPR GTTCAGGGGTGGAGCCGACC AGG (reversed) Intronic
900213967 1:1471494-1471516 GCTCCGGGGTGGTGCCGACGCGG + Intergenic
900719325 1:4165138-4165160 GTGCAGGGGTGGAGCTGTGCAGG - Intergenic
902050541 1:13560784-13560806 GTTGAGGGGTTGAGCCTTCCAGG + Intergenic
903038095 1:20507883-20507905 GGTCAGTGCTGGAGCCGGCCTGG - Exonic
908260709 1:62337738-62337760 GTTCTGGGGTGAAGGGGACCTGG - Intergenic
908620663 1:65975901-65975923 CTTCAGGGGTGGAGCCCTCCTGG + Intronic
909177633 1:72380647-72380669 CTTCAGGGGTGGGGCCCTCCTGG - Intergenic
915479776 1:156176712-156176734 GGTCAGTGGTGGGGCCGCCCTGG + Exonic
915583323 1:156829360-156829382 GTTCTGGGGTGGGGCAGAGCAGG + Intronic
917041011 1:170806432-170806454 GCTCAGGGGTTGAGCCTAGCGGG + Intergenic
918351206 1:183658064-183658086 TTTCGGGGGTGGAGCCGAGATGG + Intronic
1067007097 10:42674452-42674474 GGTCAGGGGTGGAGAAGCCCTGG + Intergenic
1067038860 10:42937929-42937951 GTAAAGGGGTGGAGCTGCCCTGG + Intergenic
1067485832 10:46649025-46649047 GTTCAGAGTTGTAGCCGATCAGG + Intergenic
1067608924 10:47692628-47692650 GTTCAGAGTTGTAGCCGATCAGG - Intergenic
1067776935 10:49170822-49170844 ATGCAGGGGTGGGGCCGGCCAGG - Intronic
1068855649 10:61795008-61795030 TTTCAGGGGTGGAACCTACAGGG - Intergenic
1069545839 10:69328063-69328085 CTTCCCGGGTGGATCCGACCCGG + Intronic
1071624511 10:87154270-87154292 GTTCAGAGTTGTAGCCGATCAGG - Intronic
1072866485 10:99067404-99067426 CTTCAGGGGTGGAACCGTCATGG - Intronic
1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG + Intronic
1077979552 11:7286171-7286193 CTTCAGGGGTGGAGCCCTCATGG - Intronic
1083630068 11:64090826-64090848 GTGCAGGGCTGGACCCGACTCGG - Intronic
1085047455 11:73362044-73362066 GTTCAGGGTGGGAGCCGCACAGG - Exonic
1086056583 11:82654136-82654158 CTGCAGGGGTGGAGCCGTCCTGG + Intergenic
1088579136 11:111299349-111299371 GGTCAGGGCCGGAGCCGCCCCGG + Exonic
1088603080 11:111500709-111500731 CTTTAGGGGTGGAGCACACCTGG - Intronic
1094725343 12:33108439-33108461 GTTGAGGGGTGGAGCCAAGATGG - Intergenic
1102668960 12:114601042-114601064 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1103923226 12:124410324-124410346 GCCCAGGGATGGAGCAGACCGGG - Intronic
1107628438 13:42316353-42316375 GTTAAGGGGTGGAGGGGTCCTGG + Intronic
1109171931 13:59107714-59107736 GTGCAGGGGTGGAGCCCTCAGGG + Intergenic
1110189508 13:72714861-72714883 CTTCAGGGGTGGAGCCCTCATGG + Intronic
1111336835 13:86836460-86836482 CTTCAGGGGTGGAGCCCTCATGG - Intergenic
1113772029 13:112916582-112916604 GTGCAGGGGTGGAGCTCAACAGG - Intronic
1114223969 14:20722206-20722228 GTTCAGGAGCGGAGCCGGCCGGG - Intergenic
1117058158 14:51934041-51934063 GTTTAGAGTTGGATCCGACCAGG + Intronic
1122745337 14:103894331-103894353 GTGCAGGGCTGGAGGTGACCAGG + Intergenic
1122817742 14:104321859-104321881 GATCAGGGCTGGGGCCCACCAGG + Intergenic
1124136381 15:27039404-27039426 GTACAGGAGTGCAGCCGGCCTGG + Intronic
1132841208 16:1979249-1979271 GTTCCGTGGAGGAGACGACCCGG - Exonic
1142495803 17:305701-305723 GTTGAGGAGAGGAGCCCACCAGG - Intronic
1142713820 17:1737382-1737404 GGTCAGAGGAGGAGCTGACCAGG - Exonic
1142768816 17:2081958-2081980 TTTGGGTGGTGGAGCCGACCAGG + Intronic
1146787404 17:35731903-35731925 GGTCAGGGGTGGAGCGGGGCCGG + Intronic
1147721756 17:42543779-42543801 GTTGAGGGCTGGAGGCGTCCTGG + Exonic
1149018298 17:51934102-51934124 GTTCAGGGCTGGAGCCAATGAGG - Intronic
1151626264 17:75277764-75277786 GTTCAGGGCTGGAGAGGACCAGG + Intronic
1151680393 17:75619906-75619928 GCTCCAGGGTGGAGCCGCCCCGG - Intergenic
1152221905 17:79073524-79073546 GTTCAGGGGTGCACCGGACGTGG - Intergenic
1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG + Intronic
1152657759 17:81527873-81527895 GGTCTGGGGTGGAGGCGACCTGG + Intergenic
1153897745 18:9582562-9582584 GTTCAGTGGTGAAGCCGTCTGGG - Intronic
1155020180 18:21889062-21889084 TTTCAGGGGTGGAGCCAAGATGG - Intergenic
1159319628 18:66830352-66830374 GTGCAGGGGTGGAGCCTTCATGG - Intergenic
1160048270 18:75407606-75407628 GTTCAGAGGCGGAGGCGAGCAGG + Intronic
1161156334 19:2733525-2733547 GCTCAGGGGTGGCGGCGACAGGG + Intronic
1161165997 19:2787837-2787859 TTTCTGGGGTGGAGCTGTCCTGG - Intronic
1161179081 19:2867429-2867451 GTGCAGGGCAGGAGCCGAGCCGG + Intronic
1161247145 19:3259394-3259416 TTTCTGGGGTGGGGCCGTCCTGG - Intronic
1161408795 19:4104852-4104874 TCTCTGGGGTGGGGCCGACCTGG + Intronic
1161416583 19:4150429-4150451 TTTCTGGGGTGGGGCCGTCCTGG + Intergenic
1161443531 19:4305326-4305348 GAACAGGGGTGGGGCCTACCTGG - Intronic
1161668263 19:5590066-5590088 TTTCAGGGATGGAGCTGTCCAGG - Intronic
1164340265 19:24387596-24387618 GTTCAGGGGAGGAGCCAAGATGG - Intergenic
1164538759 19:29106571-29106593 GTTCAGGGGCGGAGCTGGTCAGG - Intergenic
1165227472 19:34365123-34365145 GCTCAGGGGTGGGGCCGGGCCGG + Intronic
1166993223 19:46705410-46705432 GTACAGGGGGTGAGCAGACCTGG - Intronic
924993992 2:340507-340529 GGACAGGGGAGGAGCCCACCTGG - Intergenic
925020441 2:563854-563876 GTTCCGGGGTGGAGCCAGCCGGG - Intergenic
925262473 2:2540555-2540577 GTTCAGGGCTGAAGCCAGCCTGG + Intergenic
930418234 2:51117274-51117296 TTTCAGGGGTGGAGCAGATGGGG + Intergenic
935727673 2:106037892-106037914 GGTGAGGGGAGGAGCCGACGTGG - Intergenic
936814651 2:116444968-116444990 CTTCAGGGGTGGAGCCCTCATGG - Intergenic
937024915 2:118689955-118689977 GATCAGGGGTGATGCTGACCTGG + Intergenic
937240026 2:120454016-120454038 GTGCAGCAGTGGAGCTGACCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
948903779 2:240968392-240968414 GTTCGGGGCTGGAGCCAGCCCGG + Intronic
948907684 2:240987596-240987618 CTTCAGGGCTGGAGCAGGCCTGG - Intronic
948957439 2:241304720-241304742 GTTCAGGAGTGGGACCAACCAGG - Intronic
1169112627 20:3043751-3043773 GTTCAGGGGTGGAGGCACCTGGG - Intronic
1172095281 20:32457363-32457385 GTGCAGGTGTGGAGCCGCCAGGG - Intronic
1172814852 20:37678336-37678358 GTCCAGAGGTGGAGCAGAACTGG - Intergenic
1173750054 20:45469679-45469701 GGGTAGGGGTGGAGCCGAGCGGG - Intergenic
1182430673 22:30297179-30297201 GTTCAGGGCTGGAGGGGACAGGG + Intronic
1183081394 22:35458892-35458914 CCTCAGGGGTGGTGCAGACCTGG - Intergenic
1184508156 22:44916678-44916700 GTGCAGGGGAGGGGCCGCCCTGG + Intronic
949692370 3:6654862-6654884 CTTCAGGGGTGGAGCCCTCATGG - Intergenic
950589323 3:13924930-13924952 CTGCAGGGGTGGAGCCCACATGG + Intergenic
951180669 3:19654833-19654855 CTGCAGGGGTGGAGCCCACATGG - Intergenic
954628775 3:52037103-52037125 GTTCAGGGGTGGAGACTGCTGGG + Intergenic
955068647 3:55554150-55554172 GTTCTAGGGTGTAGACGACCTGG + Intronic
958154097 3:89730770-89730792 CTGCAGGGGTGGAGCCCACATGG + Intergenic
961380475 3:126493346-126493368 GCTGAGAGGTGGAGGCGACCTGG + Intronic
961452313 3:127007943-127007965 TTTCAGAGGTGGAGCAGAACTGG + Intronic
961506217 3:127372080-127372102 GGTCAGGGGAGAAGCCTACCTGG - Intergenic
963683510 3:148410224-148410246 CTTAAGGGGTGGAGCCCTCCTGG - Intergenic
963716694 3:148811751-148811773 CTTCAGGGGTGGAGCCCTCATGG + Intronic
967208444 3:187145337-187145359 CTTCAGGGGTGGAGCCCTCATGG - Intronic
968076832 3:195820608-195820630 GTTCTGGGGTGGAGCCCTCCTGG + Intergenic
968809225 4:2792664-2792686 GGGCAGGGGTGGGGCCGCCCAGG + Intergenic
969134502 4:5019503-5019525 GTGGAGGCGTGGAGCCGCCCTGG - Intergenic
969254461 4:5992805-5992827 GTTCACGGTTGGATCCGGCCAGG + Intergenic
975361293 4:73475064-73475086 TTGCAGGGGTGGAGCCCACAGGG - Intergenic
976441128 4:85076022-85076044 GTTCAGGGTTGGGTCCCACCTGG - Intergenic
976952482 4:90850243-90850265 CTTCAGGGGTGGAGCCCTCATGG + Intronic
982506038 4:156218969-156218991 GCTCAGGGGTGGAGCCCACATGG + Intergenic
982691323 4:158550582-158550604 GGTCAGGGGTGGAGCCAAGATGG - Intronic
984865546 4:184277425-184277447 CTTCAGGGGTGGAGCCCTCATGG + Intergenic
987951496 5:24682795-24682817 GCTCAGGGGTGGAGCCCTCATGG + Intergenic
989616363 5:43340765-43340787 GTTGAGGGGTGGAGCCAAGATGG + Intergenic
990143384 5:52731216-52731238 GCTCAGGGGTGGAGCCTTCATGG + Intergenic
991019524 5:61965362-61965384 GTTGAGGGGTTGAGCCAATCAGG - Intergenic
995633887 5:114163132-114163154 CTTCAGGGGTGGAGCCAAGATGG - Intergenic
997645482 5:135478941-135478963 GTAGAGGGGAGGAGGCGACCTGG - Intergenic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1005009321 6:21321220-21321242 TTTCAGGGGTGGAGATGAGCTGG + Intergenic
1006421435 6:33936439-33936461 GTTCAGGGGTGTAGCGGATATGG - Intergenic
1008337471 6:50324624-50324646 CTTCAGGGGTGGAGCCCTCTCGG - Intergenic
1009732188 6:67622477-67622499 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1011247913 6:85339296-85339318 CTTCAGGGGTTGAGCTGCCCTGG + Intergenic
1013290522 6:108715410-108715432 GCTCAGGGGTGCAGCAGAGCTGG - Intergenic
1017656021 6:156630796-156630818 GTGCAAGGGTGTAGCAGACCCGG + Intergenic
1017786784 6:157763187-157763209 GGGCAGAGGTGGAGCCCACCTGG - Intronic
1020004957 7:4777917-4777939 GTTAAGGTTTGGAGCCGGCCAGG + Intronic
1020111191 7:5448646-5448668 GTCCAGGGGTGGATCTGGCCTGG - Intronic
1020579044 7:9971408-9971430 CTTCAGGGGTGGAGCCCTCATGG + Intergenic
1026489573 7:70851113-70851135 GTTTAGGTCTGGAGCTGACCAGG - Intergenic
1026635156 7:72075669-72075691 GTGCAGGGATGGAGCTGAGCAGG - Intronic
1035357977 7:158290317-158290339 GTTCAGTGCTGGGGCCTACCAGG + Intronic
1037730731 8:21521394-21521416 TTTCAGGGTTGGAGGAGACCTGG - Intergenic
1043317397 8:78939081-78939103 GTGCAGGGGTGGAGTCCTCCTGG + Intergenic
1045331200 8:101157308-101157330 GTCCAGGGGATGAGCCCACCAGG - Intergenic
1051986608 9:23096701-23096723 CTTCAGGGGTGGAGCCCTCATGG + Intergenic
1052637209 9:31121177-31121199 CTTCAGGGGTGGAGCTGCCCAGG - Intergenic
1057186722 9:93061242-93061264 GTTCAGGGGTGAAGCCAAGAAGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1061480995 9:130897702-130897724 TTCCAGGGGTGGAGGGGACCAGG - Intergenic
1187698018 X:21940612-21940634 GTTCGGGGCTGGAGGCGTCCCGG + Exonic
1190606792 X:52151264-52151286 GTTCATGGGTGGAGCCAAGATGG - Intergenic
1195065163 X:101233420-101233442 GTTCTGGGGTGGAGCCACCCAGG - Intronic
1197978098 X:132186743-132186765 GATCTGGAGTGGAGCGGACCAGG + Intergenic
1199481798 X:148305847-148305869 GTACAGGGGTGGAGCCAAGATGG - Intergenic