ID: 1002441269

View in Genome Browser
Species Human (GRCh38)
Location 5:179265672-179265694
Sequence GGCCGGCGCTGGGAAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002441269_1002441275 -1 Left 1002441269 5:179265672-179265694 CCTCGGCTTTCCCAGCGCCGGCC 0: 1
1: 0
2: 4
3: 20
4: 181
Right 1002441275 5:179265694-179265716 CCCCGCCCACCCCTTCCGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 266
1002441269_1002441285 17 Left 1002441269 5:179265672-179265694 CCTCGGCTTTCCCAGCGCCGGCC 0: 1
1: 0
2: 4
3: 20
4: 181
Right 1002441285 5:179265712-179265734 CGTGGGCCACATCACCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 136
1002441269_1002441277 0 Left 1002441269 5:179265672-179265694 CCTCGGCTTTCCCAGCGCCGGCC 0: 1
1: 0
2: 4
3: 20
4: 181
Right 1002441277 5:179265695-179265717 CCCGCCCACCCCTTCCGCGTGGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002441269 Original CRISPR GGCCGGCGCTGGGAAAGCCG AGG (reversed) Intronic
901086338 1:6614210-6614232 GGCCGACGAGGGGAAAGCGGGGG - Intronic
903174748 1:21574172-21574194 GGCCGGCGCTGAAAGAGCCTGGG - Intronic
905151413 1:35930969-35930991 GGCCGGCGCGGAGGACGCCGGGG - Intronic
905771125 1:40638662-40638684 GGCAGGGGCTGGGACAGCCCAGG + Intronic
906650405 1:47508637-47508659 GGGCTGCGCTGGGCACGCCGAGG + Intergenic
907459639 1:54597763-54597785 GGCAGGGGCTGGGAAAGTGGAGG - Intronic
907466571 1:54641757-54641779 GGCCTGGGCTGGGGAAGCCTAGG + Intronic
907746414 1:57218153-57218175 GGACGAGGTTGGGAAAGCCGTGG + Intronic
912777252 1:112513526-112513548 GGCCGGCTGTGGGAATGCAGGGG + Intronic
913680853 1:121186271-121186293 GGTCGGAGCCGGGAAAACCGGGG - Intronic
914032686 1:143973913-143973935 GGTCGGAGCCGGGAAAACCGGGG - Intergenic
914156760 1:145094054-145094076 GGTCGGAGCCGGGAAAACCGGGG + Intronic
915118921 1:153616508-153616530 GGCTGGGGCTGGGAAACCCCTGG + Intronic
916651553 1:166839270-166839292 GGGCGGGGCGGGGAAGGCCGAGG + Intergenic
920468166 1:206204797-206204819 GGTCGGAGCCGGGAAAACCGGGG - Intronic
923171460 1:231421520-231421542 GGCCGCCGCTGGGTCGGCCGGGG + Exonic
923248834 1:232160774-232160796 GGCCGGTGCTGGGCAGTCCGTGG + Intergenic
1063201070 10:3785616-3785638 AGCCGGGGCTGGGAGAGCCGGGG + Intergenic
1063349045 10:5337675-5337697 GGCCGGTCCTAGGAAAGCTGTGG + Intergenic
1065102046 10:22340862-22340884 GGCCTGAGCTGGGAAAGGCGCGG - Intergenic
1069958482 10:72066033-72066055 GGCTGGAGCTGGGGAAGCCCTGG - Intronic
1069960742 10:72077727-72077749 GGCCGGCCCTGGGAGAACCCAGG + Intronic
1072664145 10:97381640-97381662 GGCCAGTGCTGGGAAAGACAGGG + Intronic
1072664856 10:97385386-97385408 GGCAGGAGCTGGGAAAGCCAAGG - Intronic
1072926277 10:99620194-99620216 GGCCGGCGGCGGGGAGGCCGGGG - Exonic
1075430148 10:122373764-122373786 GGCATGCGCTGTGAAAGGCGTGG + Intergenic
1076650136 10:131981867-131981889 TGCGGGCGGTGGGAAAGCGGAGG + Exonic
1076746819 10:132518666-132518688 GGCCAGCGCAGGAAAAGGCGGGG + Intergenic
1076786753 10:132753642-132753664 GCCCGGCCCTGGGACAGCCGAGG - Intronic
1077237714 11:1489888-1489910 GGCTGGGGCTGGGAATGCAGGGG - Intronic
1084086837 11:66858764-66858786 GACCGGCGCTGGGGACGCTGGGG + Exonic
1089205450 11:116757933-116757955 TGCCGGCTCTGGGCAAGCCTGGG + Exonic
1091920825 12:4303246-4303268 GGCTGCCGATGGGAAAGTCGGGG + Exonic
1096802521 12:54120592-54120614 GGACGGGGCTGGAAAAGCCATGG - Intergenic
1097107897 12:56635933-56635955 GGAGGGGGCTGGGAAAGCCCTGG + Intronic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1101287860 12:103334644-103334666 GGCTGGGGCTGGGAACGCAGGGG - Intronic
1103575345 12:121873314-121873336 GGGCTGCTCTGGGAAAGCTGTGG - Intergenic
1103909536 12:124344700-124344722 TGCCTGAGCTGGGTAAGCCGCGG - Exonic
1105071438 12:133236223-133236245 GGGCGGCGCGGGGTCAGCCGTGG - Intergenic
1105691898 13:22848969-22848991 GGCCGGGGCTGCGGAAGCCCTGG - Intergenic
1110119474 13:71865363-71865385 GGGCCCCGCTGGGAAAGGCGAGG - Intronic
1112691756 13:101904215-101904237 GGTCGGTGCTGGTAAAGCCCTGG - Intronic
1113054626 13:106254693-106254715 GTCCTCCTCTGGGAAAGCCGGGG - Intergenic
1113427281 13:110219045-110219067 TGCCGCCGCTGGGAAAGGGGTGG + Intronic
1114989063 14:28264471-28264493 TGCGGGCGGTGGGAAAGCAGAGG - Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1122341352 14:101030503-101030525 GGCAGGCGTTGGGACAGCTGTGG + Intergenic
1123630785 15:22258299-22258321 GGCCCGCGCGGGGGAGGCCGGGG - Intergenic
1129592758 15:76931898-76931920 GGCCGGCGCCGGCAAGGCCGAGG + Exonic
1129689573 15:77705598-77705620 GGCAGGGGCTGGCAAAGCCTCGG + Intronic
1130650192 15:85758101-85758123 GGCCGGGGCTGCGAAGGCCAGGG + Intergenic
1130887963 15:88109643-88109665 GGGGGGCGTTGGGAAAGCCCAGG + Intronic
1131472322 15:92708071-92708093 GGCAGGAACTGGGAAAGCAGAGG - Intronic
1132233171 15:100200055-100200077 AGCCAGCGCTGGGAGAGCCAGGG + Intronic
1132729217 16:1352326-1352348 GGCCGGCGCGGGGGTGGCCGCGG + Intronic
1133050206 16:3113102-3113124 AACCGGCTCAGGGAAAGCCGAGG - Intronic
1133225325 16:4337986-4338008 GGCAGGGGCTGGGTAAGCCTAGG - Exonic
1135586969 16:23678974-23678996 GGCCGACCCTGGGAAAGCCGGGG + Exonic
1136413218 16:30089079-30089101 GGCCGGCGCTGGGAGCCCAGCGG - Exonic
1136470124 16:30474181-30474203 GGCCGGCGCTGAGGAAGGCAAGG - Exonic
1137676683 16:50307079-50307101 GGCTGGCGCAGGCAAAGTCGTGG - Exonic
1140378904 16:74468885-74468907 GGCCAGGGCTTGGAAAGCTGGGG - Intronic
1141523176 16:84594889-84594911 GGCAGACGCTGGAAAAGCCATGG - Intronic
1142361711 16:89630647-89630669 TGCCGGGGCTGGGGGAGCCGGGG + Intronic
1142361735 16:89630692-89630714 TGCCGGGGCTGGGGGAGCCGGGG + Intronic
1142712485 17:1730966-1730988 GCCCGGGGCTGGGAAGGCTGAGG + Intronic
1142752793 17:1998495-1998517 GGCCGGCCCGGGGGCAGCCGCGG - Intronic
1142966899 17:3587262-3587284 GTCCGGGGCTGGGAAAGGCCTGG - Intronic
1143166824 17:4900979-4901001 TGCCGGCGCAGGGTAAGCAGTGG - Exonic
1143514012 17:7410465-7410487 GGCAGGCGCTGGGATGGCAGAGG - Intronic
1143586781 17:7854470-7854492 GGCCGGGGCTGGGAAGGACGGGG - Exonic
1144269011 17:13600467-13600489 GTCCTGGGCTGGGAAAGACGTGG - Intronic
1146944737 17:36865911-36865933 GGCTGGAGCTTGGAAAGCGGAGG + Intergenic
1147311628 17:39599204-39599226 GGCCCGCGCCGGGAATACCGCGG - Intergenic
1147602575 17:41755354-41755376 TGCCTGAGCTGGGGAAGCCGGGG - Exonic
1150692265 17:67377107-67377129 GGCCGGCGCTGGGGAGGCTCGGG - Intergenic
1151537723 17:74748387-74748409 GGCCGGCGCTGGGGTGGCAGGGG - Intergenic
1151542822 17:74773482-74773504 GGCCGGGGCTGGGAAAGGGAAGG + Intronic
1151683278 17:75633063-75633085 GACCTGGGCTGGGACAGCCGAGG + Intronic
1152231466 17:79115921-79115943 GTGCTGCGCTGGGAATGCCGGGG + Intronic
1152570669 17:81119987-81120009 TGGGGGCGCTGGGAGAGCCGGGG + Exonic
1152741117 17:82018893-82018915 GGCAGGTGCTGGGAAAGGCCTGG - Exonic
1152852963 17:82648414-82648436 GGCCGGCGCTGAGGCCGCCGCGG + Exonic
1152888800 17:82868126-82868148 GGCGGGCTCTGGGAATGGCGCGG + Intronic
1156266970 18:35497902-35497924 GGCCCGCGCTGGGAAAAAGGTGG - Exonic
1157374488 18:47150522-47150544 GGGCGGAGCCGGGAAATCCGGGG - Intronic
1160179651 18:76622963-76622985 AGCCGGCCCTGCAAAAGCCGGGG - Intergenic
1160463577 18:79057383-79057405 GGCAGGGGCTGGGGAAGCTGTGG + Intergenic
1160499377 18:79394648-79394670 GGCCTGCGGTGGAAAAGCCGGGG + Intergenic
1160699284 19:498277-498299 GGCCGGCCCTGGGAGAGTTGGGG - Intronic
1160874576 19:1291121-1291143 GGCCGGCCCGGGGGAAGCCAGGG + Intronic
1161018857 19:1998456-1998478 GGCCCCAGCTGGGAAAGCGGTGG + Intronic
1162524634 19:11200341-11200363 GGCAGGCGCTGGGTAAGCAGGGG + Exonic
1162955902 19:14097720-14097742 GGGCAGCCCTGGGGAAGCCGTGG - Intronic
1163507951 19:17719470-17719492 GGCGGGCGCCGAGAACGCCGGGG + Exonic
1163575721 19:18109915-18109937 GGCCGGGGCGGGGAGAGGCGGGG + Intronic
1163692237 19:18744179-18744201 GGCTGGCGCCGGGGACGCCGCGG - Intronic
1164647814 19:29872566-29872588 GGCAAGCACTGGGAAAGCGGAGG - Intergenic
1166042849 19:40213803-40213825 GGCCGGCGCGGGGAAAGAAGAGG - Exonic
1166705038 19:44903794-44903816 GGCCGGAGCACGGAAAGCAGCGG + Intergenic
1166750235 19:45161056-45161078 GGCAGGCGCTGGGGAAGGGGCGG - Intronic
1167085902 19:47309662-47309684 GGCCGGCGCTCGGAAAACCGAGG - Intronic
1167426516 19:49432477-49432499 GGCCGGCTCTAGGACAGCCTGGG - Intronic
1167627857 19:50604452-50604474 CCCTGGCGCTGGGAAAGGCGCGG - Intergenic
1167628215 19:50606347-50606369 CCCTGGCGCTGGGAAAGGCGCGG - Intergenic
1167735961 19:51294705-51294727 GGCTGGCGCTGGGGAGGCCCCGG - Intergenic
1168239837 19:55083541-55083563 GGCCGAGGCTGGGAAGTCCGGGG + Intronic
1168581633 19:57559886-57559908 GGCCGGCGCAGGAAAAGGCGTGG - Intergenic
925040477 2:729679-729701 GGCCGTTGATGGGAAAACCGTGG + Intergenic
926231359 2:11006468-11006490 TGCCTGCGATGGGAAAGCCATGG + Intergenic
927747081 2:25633277-25633299 GGCAGGCGCTGGGCAGGCTGAGG - Intronic
927755496 2:25705198-25705220 GGCAGGCGCTGGGCAGGCTGAGG - Intergenic
929692630 2:44087255-44087277 GGCCGGCGCTGGAAAGGCGCGGG - Intergenic
931994286 2:67824793-67824815 GGCCGGAGGCGGGAAATCCGGGG - Intergenic
937450781 2:122000696-122000718 GGCGGTTGCTGGGAAAGCCCTGG + Intergenic
937733590 2:125262450-125262472 GTCAGGCCCTGGGAAAGCTGAGG - Intergenic
938386564 2:130870968-130870990 GGCTGGTGCTAGGTAAGCCGTGG + Intronic
939990768 2:148875555-148875577 GGCCGGGGCCGGGAACGACGAGG - Exonic
1169119331 20:3085618-3085640 GGCCTGGGGTGGGAGAGCCGGGG + Intergenic
1169191489 20:3661282-3661304 CGCCGACCCTGGGAAAGGCGCGG + Exonic
1171499795 20:25585053-25585075 GGCCCGCGCTGGGCAGGCGGCGG + Intronic
1172284649 20:33732160-33732182 CGCCGGGGCTGGAACAGCCGCGG + Intronic
1172768764 20:37364833-37364855 GGCCGGGAGTGGGAAAGCCCGGG - Intronic
1175991635 20:62792828-62792850 GGCCAGGGCTGGGAATGGCGTGG - Intergenic
1176515036 21:7777583-7777605 GGTGGGAGCTGGGAATGCCGTGG - Intergenic
1177187917 21:17818950-17818972 AGCCGGAGCTGGGAGAGCCGCGG + Intronic
1178198160 21:30372075-30372097 GGCAGGTGCTGGGAGAGCAGAGG + Exonic
1178202694 21:30425774-30425796 GGCAGGTGCTGGGAGAGCAGAGG + Exonic
1178203062 21:30430377-30430399 GGCAGGTGCTGGGAGAGCAGAGG - Exonic
1178203556 21:30436828-30436850 GGCAGGTGCTGGGAGAGCAGAGG + Intergenic
1178649064 21:34407595-34407617 GGTGGGAGCTGGGAATGCCGTGG - Intronic
1179625060 21:42644636-42644658 GGCCGGCCCTGGGAGAGTGGTGG - Intergenic
1180342443 22:11629106-11629128 CGGCGGCGGTGGGGAAGCCGCGG + Intergenic
1183931349 22:41237790-41237812 GGGTGTCGCTGGGGAAGCCGCGG + Exonic
1184782822 22:46657641-46657663 GGGCTGCTCTGGGAAAGCCTCGG - Intronic
949709830 3:6860996-6861018 GGCTGGCGCTGGGAAGGGTGGGG + Intronic
950423969 3:12914740-12914762 GGCAGGCACTGGGAGAGCCTGGG + Intronic
954443207 3:50532994-50533016 GGCAGGCGGTGGGCAAGCCTTGG + Intergenic
954577585 3:51685092-51685114 GGCCAGGGCTGGGACAGCAGTGG + Intronic
954615691 3:51967738-51967760 GGGCGGTGCGGGGAAGGCCGTGG - Intronic
963038330 3:141051239-141051261 GGCCCGAGCTGGGACGGCCGGGG + Intergenic
963827372 3:149970458-149970480 GACCGACGCTGGGAACGCCGGGG + Intronic
964571296 3:158110019-158110041 GCCAGGCGCTGGGAATGCCGAGG - Intronic
966860687 3:184229761-184229783 GGCCCGCGCAGGGGATGCCGCGG - Intronic
967732202 3:192917213-192917235 AGCCGGCGTCGGGAAAGCGGAGG + Intronic
968025977 3:195442864-195442886 AGGCGGCGCTGGCAAAGCCGAGG + Exonic
968235372 3:197027941-197027963 GGCCGGGGCTGGGCAGGGCGGGG - Intronic
969054496 4:4393187-4393209 CGCCGGGGCTGGGAAAGCAAAGG - Intronic
972305526 4:37826629-37826651 GGCGGGGGCGGGGAGAGCCGCGG - Exonic
981098522 4:140806101-140806123 GGCCAGCTCTGGGAAGGCCTTGG + Intergenic
987050378 5:14143465-14143487 GGCCGGCGCCCGGGAGGCCGTGG + Intergenic
989582196 5:43043326-43043348 AGCCGGCGCTGGGAAAGGAACGG + Intergenic
992400082 5:76403647-76403669 GGACGGCGTTGGAGAAGCCGAGG + Intronic
994075728 5:95647136-95647158 GGCCGGGGCTGCGGAAGCCCTGG - Exonic
997582972 5:135028729-135028751 GGCCGGAGCGGGGAAGGGCGCGG - Exonic
998138501 5:139687133-139687155 GGCAGGCGCTGGGCAGGCTGGGG - Intergenic
999143178 5:149376322-149376344 TGCCGGCACTGGGAAGGCCCAGG + Intronic
1002415653 5:179119633-179119655 GGCCAGCCCCGGGAAAGCCTGGG - Intronic
1002441269 5:179265672-179265694 GGCCGGCGCTGGGAAAGCCGAGG - Intronic
1003603769 6:7541843-7541865 GGCCGGCGCGGAGAAAGCGGAGG - Exonic
1004504713 6:16238615-16238637 GGGCGGCGCGGGGAGCGCCGGGG - Exonic
1006804970 6:36782153-36782175 GGCCAGGGCTGGGAAGGCTGGGG - Intronic
1007576146 6:42926370-42926392 TGCCAGCGCTGGGCAAGCAGGGG - Intergenic
1007938259 6:45753139-45753161 GCCAGGCGCTGGGCCAGCCGTGG - Intergenic
1008920966 6:56843800-56843822 GGCCGGAGCTGAGCCAGCCGGGG - Intronic
1017810847 6:157982184-157982206 GGGCGGCGCTGGGACTGCCGGGG + Intronic
1018613029 6:165662100-165662122 GGCCGGCGCCGGGGAAGCCGGGG + Intronic
1018728030 6:166628102-166628124 GGCCCGCGCTGGGAATACCCGGG + Intronic
1019379278 7:712636-712658 GGCGGGGGCGGGGAGAGCCGGGG - Intronic
1019504731 7:1385252-1385274 GGCCGGGGCAGGGCAGGCCGGGG + Intergenic
1019538120 7:1539294-1539316 GGACGGCCCTGGGATAGCAGGGG - Intronic
1019569972 7:1706554-1706576 GGGCTGCACTGGGAAGGCCGGGG - Intronic
1022106388 7:27200309-27200331 GGCTGGCGCTGGGGACGGCGCGG - Intergenic
1022114686 7:27251691-27251713 GGCCCGGGCTGGGCAAGCCGAGG + Intergenic
1023938434 7:44755651-44755673 GCCAGGGGCTGAGAAAGCCGAGG - Intronic
1023972241 7:45000119-45000141 GGCCTGCGCTGGGGAAGGTGGGG + Intronic
1025002160 7:55325524-55325546 GGCCGGCACTTGGCAAGCTGAGG + Intergenic
1025912774 7:65841165-65841187 GGCAGGAGCTGGGAAAGAAGAGG - Intergenic
1029490107 7:100866278-100866300 GGCCGGGGCTGGGGAACCCGAGG + Exonic
1029683039 7:102125463-102125485 GGCCGCCGCTGGGAGGGCCTTGG + Intronic
1029688899 7:102167450-102167472 GGCCAGCGCTGGGGAAGTCCCGG - Intronic
1032018449 7:128393861-128393883 GGCCAGCGCTGGGGCAACCGTGG - Intronic
1032090839 7:128910720-128910742 AGCAGGCGCTGGGGAAGGCGGGG + Intergenic
1034064652 7:148124528-148124550 GGGAGGCGCTGGGGAAGCTGAGG + Intronic
1034338567 7:150338556-150338578 GGCCAGCCCTGGGAATGCTGAGG - Intronic
1035736551 8:1891562-1891584 GGCCTGAGCTGGGAGAGCTGCGG - Intronic
1037928950 8:22865866-22865888 CGCCCGAGCTGGGACAGCCGGGG - Intronic
1038462466 8:27728561-27728583 GGCCGTCGCTGGGGAAGAGGAGG + Intergenic
1040055876 8:43056466-43056488 GGCCGAGGCTGGGGAAGCCGTGG + Exonic
1041830210 8:62144726-62144748 GGCCGTCCCTGGGAAAGCCGGGG - Intergenic
1049765771 8:144354565-144354587 GGGCGGGGCTGGGAAGGGCGGGG - Intronic
1052903702 9:33816882-33816904 GGCGGGCGCAGGGATTGCCGTGG - Intergenic
1053129883 9:35608909-35608931 GACCGGCTTCGGGAAAGCCGGGG - Exonic
1053381281 9:37651162-37651184 GGGCGGCGCGGAGGAAGCCGAGG - Intronic
1056475215 9:86946492-86946514 GGCCGAGGCCGGGAAAGCGGCGG + Exonic
1056488647 9:87084131-87084153 GGCCGGAGCTGGCAAGGCCGAGG - Intergenic
1057466247 9:95317256-95317278 GGCCAGGGCGGGGAAAGCGGGGG - Intronic
1059123386 9:111661864-111661886 GGAGGGCGCGGGGCAAGCCGGGG + Intronic
1060376666 9:123120502-123120524 GGCAGGGGCGGGGAAAGCAGGGG + Intronic
1061015880 9:127980656-127980678 GGCCAGCGCAGGTGAAGCCGGGG + Intergenic
1061799764 9:133107346-133107368 GGCTGGTGCTGGGGAAGCTGAGG + Intronic
1061908210 9:133709442-133709464 GCGGGGTGCTGGGAAAGCCGGGG - Intronic
1062537484 9:137027343-137027365 AGGCAGTGCTGGGAAAGCCGGGG + Intronic
1185835744 X:3345393-3345415 GGCAGGGGCGGGGAAAGCCCGGG - Intronic
1199600828 X:149540258-149540280 GGGCGGGGCTGGGAGAGGCGGGG - Intergenic