ID: 1002444730

View in Genome Browser
Species Human (GRCh38)
Location 5:179282899-179282921
Sequence GCTCCCATCTCAAGATGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002444730_1002444735 23 Left 1002444730 5:179282899-179282921 CCATGTCATCTTGAGATGGGAGC 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1002444735 5:179282945-179282967 TGAGCCACTGTGAGCAACTCTGG 0: 1
1: 0
2: 0
3: 43
4: 406
1002444730_1002444736 24 Left 1002444730 5:179282899-179282921 CCATGTCATCTTGAGATGGGAGC 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1002444736 5:179282946-179282968 GAGCCACTGTGAGCAACTCTGGG 0: 1
1: 0
2: 1
3: 16
4: 202
1002444730_1002444733 0 Left 1002444730 5:179282899-179282921 CCATGTCATCTTGAGATGGGAGC 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1002444733 5:179282922-179282944 CCTAAGTCTATCAACTAACCAGG 0: 1
1: 0
2: 0
3: 4
4: 125
1002444730_1002444738 30 Left 1002444730 5:179282899-179282921 CCATGTCATCTTGAGATGGGAGC 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1002444738 5:179282952-179282974 CTGTGAGCAACTCTGGGCCCTGG 0: 1
1: 0
2: 2
3: 25
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002444730 Original CRISPR GCTCCCATCTCAAGATGACA TGG (reversed) Intronic
906829023 1:49012199-49012221 GCTCGAATATAAAGATGACACGG + Intronic
909727366 1:78851472-78851494 TCTCCCATCTCAAGATTTTAGGG - Intergenic
913533940 1:119753689-119753711 TCTCCCCTCTCATGAGGACAGGG + Intronic
915538498 1:156552264-156552286 GCTCCCATGTTTAGATGTCAGGG - Intronic
916802391 1:168226697-168226719 GCCCCCATCCCATGAGGACAGGG + Intronic
918234866 1:182570689-182570711 GCTCCCACCTCATGAGGACAGGG + Intergenic
919825199 1:201498601-201498623 GCTCCCATTTGAGGGTGACACGG + Intronic
920553700 1:206887511-206887533 GCTGCCATCTCAACATGGCAGGG + Intergenic
921047065 1:211485182-211485204 TCCCCCATCTCCAGATGGCAGGG + Intronic
923744948 1:236691726-236691748 TCTCCCATCTCTTGATGAAAGGG - Intronic
924205116 1:241704219-241704241 GCTCCCTTCTCAGGATGGCAGGG - Intronic
1065753748 10:28912166-28912188 ATTCCCATCCCAAGATGACTGGG - Intergenic
1067324474 10:45253818-45253840 GCTCCCAACTCAAGAACCCAGGG - Intergenic
1071060544 10:81565937-81565959 GGTCCCATCTCAAAATTAAAAGG + Intergenic
1074015219 10:109527787-109527809 GCTAGCATCTCCAGATGAGAAGG + Intergenic
1074523988 10:114248908-114248930 GGTCCAAGCACAAGATGACATGG - Intronic
1075851817 10:125595213-125595235 GCTCACCTGTCAAGATGACTGGG - Intronic
1075985097 10:126778508-126778530 GCACCAATCTCCAGATGAAATGG + Intergenic
1076195158 10:128512577-128512599 GCTTCCCTCTGAAGATGAAAAGG - Intergenic
1076987816 11:252173-252195 GCTCCTATCTTAAGATTAAAAGG - Intronic
1078790873 11:14540792-14540814 TCCCCCATCCCAAAATGACAGGG - Intronic
1079261310 11:18884617-18884639 GCTCCCACCTGAAAATCACAGGG - Intergenic
1079269390 11:18969462-18969484 GCTCCCACCTGAAAATCACAGGG - Intergenic
1080331066 11:31139475-31139497 GCTCTCATCTCGAGAGGAAACGG + Intronic
1080376845 11:31723116-31723138 TGTCCCATCTCAAGATGCCATGG + Intronic
1088911009 11:114192606-114192628 GCTCCCCTCCCATCATGACAGGG - Intronic
1091277585 11:134362813-134362835 CCTCCCATCTCATGGTGACCAGG + Intronic
1094374121 12:29772258-29772280 GTGCCCATCTCGAGAGGACAAGG + Intronic
1101739028 12:107485471-107485493 GCTTCCATCTCAAGAAGCAAAGG - Intronic
1101815365 12:108141911-108141933 GCTCCCATCTCAAGTTGACGGGG - Intronic
1102937814 12:116912063-116912085 GCTCCCAGGTTAAGAGGACAAGG + Intronic
1103266022 12:119630924-119630946 GCTCTCATCTCATGAAGAGATGG + Intronic
1103560241 12:121789817-121789839 GTTCCCATCTCAGGCTGAAAAGG + Intronic
1105878301 13:24580288-24580310 GCTAGCATCTCCAGATGAGAAGG - Intergenic
1105921552 13:24968786-24968808 GCTAGCATCTCCAGATGAGAGGG + Intergenic
1106665021 13:31842614-31842636 GCTCACGCCTCTAGATGACATGG - Intergenic
1112733164 13:102389565-102389587 GGCACCATCTCTAGATGACAAGG - Intronic
1114224072 14:20722873-20722895 GGTCCCATCTCAGGATGAGATGG - Intergenic
1115390227 14:32846015-32846037 GATCCCAAGTGAAGATGACAAGG + Intergenic
1117323840 14:54650462-54650484 GCTGCTATAACAAGATGACAAGG - Intronic
1119749311 14:77066312-77066334 GGTCCCAGCTCTAGAGGACATGG + Intergenic
1120942443 14:89961635-89961657 GCTCCCATCTCATCATGGCCCGG + Intronic
1122995424 14:105261309-105261331 GCTCCCATCAGCAGATGACAAGG + Intronic
1123434732 15:20246883-20246905 GCTCCCATCTCAAGCAGAACAGG - Intergenic
1124345037 15:28916531-28916553 GCTCCCCTCCCCAGAGGACATGG + Intronic
1126776748 15:52106928-52106950 GCTGTCATCACAAGAGGACATGG + Intergenic
1128774387 15:70308608-70308630 GCACCCACCTCAACATGAGAGGG + Intergenic
1128778959 15:70345384-70345406 TCTCCCATCTCATGATGGCAAGG - Intergenic
1129113216 15:73350329-73350351 GCTCCCATGTGAACATGAAAAGG - Intronic
1129179716 15:73866358-73866380 GCTGCCATCTAAAGATAACCAGG + Intergenic
1132118969 15:99160025-99160047 CCTCACATCTCTAGAAGACAAGG - Intronic
1132138287 15:99366456-99366478 GCTGCCATAACAAAATGACAGGG + Intronic
1136125417 16:28176047-28176069 GGTCCCATCTCAGGATAAGATGG - Exonic
1137686709 16:50391621-50391643 GCCTCCTTCTCACGATGACAGGG - Intergenic
1139589727 16:67926926-67926948 GCTCCAATCTCTGGATGACCAGG - Intronic
1141921610 16:87139258-87139280 GCTGCCCTCTGAAGATAACAAGG - Intronic
1145118800 17:20236934-20236956 GCAGCCATCTCTAGATGAAAGGG + Intronic
1151686367 17:75649207-75649229 TCTTCCATCTCAAGATGCCGAGG + Intronic
1154111887 18:11577326-11577348 GCCCCCATCTCAGGCTCACAAGG + Intergenic
1157233716 18:45943442-45943464 GCTCCCATATCAACATGAAATGG + Intronic
1157318495 18:46615196-46615218 GGTCCCATAGCAATATGACATGG - Intronic
1158407015 18:57168759-57168781 AGTTCCATCTCCAGATGACATGG - Intergenic
1166649516 19:44561889-44561911 GCTCCCAACTCAAGATATTAGGG + Intergenic
1168278284 19:55289166-55289188 GTTCCCCTCTGAAGCTGACATGG + Intronic
926874443 2:17459010-17459032 ACTCCCAGGTAAAGATGACATGG + Intergenic
926930994 2:18040738-18040760 GCTCTCCTCTTAAGAAGACAGGG - Intronic
930728328 2:54704288-54704310 GCTCTCATCACAGGATCACAGGG - Intergenic
930773023 2:55146639-55146661 GCTCCCTTCTTGATATGACAGGG - Intergenic
935133483 2:100278715-100278737 GCTCACGGCTGAAGATGACATGG + Exonic
936005422 2:108882913-108882935 GCTCCTATATAAAGAAGACAAGG - Intronic
936005436 2:108883001-108883023 GCTCCTATATAAAGAAGACAAGG - Intronic
936731503 2:115386608-115386630 GCTGCTATCTCAAGTTGATAAGG + Intronic
937766831 2:125671157-125671179 TCTCACCTCTCAAGATGTCAGGG - Intergenic
938770980 2:134500423-134500445 GCTCCCATCTCCAGAGGGGAAGG - Intronic
938899779 2:135790251-135790273 GGTCCCATCTCAAGTTGTTAGGG + Intronic
939124962 2:138166201-138166223 GCCTCCATCTCCAGATGAGAGGG + Intergenic
943740719 2:191405223-191405245 GCTGCAATCTCAAGATAAGATGG - Intronic
944653587 2:201856584-201856606 GCTCCTATCTCCAGTTGCCATGG + Intronic
945084336 2:206116391-206116413 GCGCCCATCCCAAGCTGCCAGGG + Intronic
945781263 2:214175421-214175443 CGTCTCATCTCAAGATGAGATGG + Intronic
947572909 2:231249773-231249795 GCTCCCATCTGAAGATGTCTGGG - Intronic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1171960088 20:31487091-31487113 GCTCCCACCTCAACATCCCAAGG + Intergenic
1175331952 20:58171234-58171256 GCTGCCCTCTCAACAGGACATGG - Intergenic
1175498501 20:59432436-59432458 GCTCCTATCTCTACATGACAGGG + Intergenic
1178930145 21:36810875-36810897 GCTCCCATCTCCTTTTGACAGGG - Intronic
1180715538 22:17869452-17869474 TGTCTCTTCTCAAGATGACAGGG + Intronic
1183028203 22:35082382-35082404 GCTCCAAGCTCAAGAAGCCAGGG + Intronic
1184371632 22:44085864-44085886 GCTGCCATCTGAATAGGACAGGG + Intronic
953103258 3:39851051-39851073 TCTCTAATATCAAGATGACAGGG + Intronic
953873176 3:46645254-46645276 CCTCCTACCTCAAGATGAAAGGG + Intergenic
954646942 3:52137438-52137460 CCTCCCATCTCAAGTGGGCATGG + Intronic
956045242 3:65189283-65189305 GCTGCCTTCTCCAGATGACGTGG - Intergenic
956157297 3:66312113-66312135 ACTCCCATCTCCATAAGACAGGG - Intronic
957354639 3:79065730-79065752 GTTCCCCTCTGAAGATGACTAGG + Intronic
958536050 3:95405450-95405472 GCTTTCATCTCAAGAACACATGG - Intergenic
960945819 3:122965877-122965899 GCTCCCATCTCATGTAGCCATGG - Intronic
966203081 3:177377604-177377626 CCTTCCGTCTCAAGATGATAAGG + Intergenic
966910428 3:184556590-184556612 GCTCCCTGCTCAGGAGGACAGGG - Intronic
970479607 4:16459789-16459811 GGTGCCATCTCCAGATGACAGGG + Intergenic
971574680 4:28257549-28257571 GATGCTATCTCAAGATGACCAGG - Intergenic
973194005 4:47418927-47418949 GCTCACATTTCATTATGACAAGG - Intronic
977686483 4:99852535-99852557 GCTCCCCTCTCCAGATGGAAGGG + Intronic
986200759 5:5576157-5576179 GCTCCCCTCTCAACCTCACAGGG - Intergenic
986495205 5:8334272-8334294 TCTCACATCTCAACATGCCAAGG - Intergenic
988406251 5:30827084-30827106 GCTAGCATCTCCAGATGAGAAGG - Intergenic
989716880 5:44474485-44474507 GCTCCTATGTCAAAATAACAGGG - Intergenic
990054363 5:51552841-51552863 GCTCCCAACAGAAGATAACAGGG + Intergenic
994557998 5:101329740-101329762 GCTCTTATCTCAAAATCACATGG - Intergenic
999254810 5:150204415-150204437 GCTGACAGCACAAGATGACAGGG - Intronic
999553065 5:152711084-152711106 GCTACCATCTCAAGAAAATAGGG - Intergenic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1002444730 5:179282899-179282921 GCTCCCATCTCAAGATGACATGG - Intronic
1006204848 6:32331592-32331614 TCTCCCAGCTGAATATGACAGGG - Intronic
1006878740 6:37320861-37320883 GCTCGCATTTCAAGCTGCCACGG - Intronic
1007212518 6:40206711-40206733 GCTCCAGTTTCAAGATGGCATGG + Intergenic
1007818423 6:44541632-44541654 GCTCTTGTCTCAAGATGTCAAGG - Intergenic
1009764539 6:68054423-68054445 GCTCCCTTCACATAATGACAGGG - Intergenic
1011514295 6:88135601-88135623 CCTCTGATCTCAAGATGACAGGG - Intergenic
1016336541 6:143011426-143011448 ACTCCCATGTCAAAATGGCAAGG - Intergenic
1023497537 7:40814793-40814815 GCTAGCATCTCCAGATGAGAAGG - Intronic
1026793140 7:73348107-73348129 TGTCCCATAACAAGATGACAGGG - Intronic
1027057662 7:75061142-75061164 GCTCACAGCTCCACATGACACGG + Intronic
1027164323 7:75823708-75823730 CCTCCCATCTGGAGATGAAAGGG - Intergenic
1030109302 7:106012964-106012986 GCTCCCCACTCCAGATGGCATGG - Exonic
1032011302 7:128349923-128349945 GATCCCAGCTCAAGGTGACCAGG + Intergenic
1032257602 7:130309654-130309676 GAGACAATCTCAAGATGACATGG + Intronic
1040098225 8:43469857-43469879 GCTCCCATCTCAAGATCCTAGGG + Intergenic
1040691216 8:49940997-49941019 GTTCCCATCTCTAAATGGCAAGG - Intronic
1041725408 8:61013096-61013118 CCTGCCATCTCCAAATGACATGG - Intergenic
1048973944 8:139660915-139660937 GCTCCCATGGCCAGAGGACAGGG - Intronic
1051360672 9:16278836-16278858 GGTCTCCTCTGAAGATGACAAGG + Intergenic
1058598048 9:106637166-106637188 GCCCTCATCACAAGATGACTAGG + Intergenic
1058641588 9:107091711-107091733 GCTCCCATCTCAAGAACATAAGG + Intergenic
1061016165 9:127981797-127981819 GCTCCCAGCTCAAGACCACCAGG + Intergenic
1187597523 X:20789712-20789734 GTTCCCATCTCAAGAAGCAATGG + Intergenic
1188671846 X:32890148-32890170 GCTCTTGTCTCAAGATGACTTGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1194172341 X:90602425-90602447 GCCACCATCTCCAGATGAGAAGG + Intergenic
1194761094 X:97797098-97797120 CCTCCCATCTCATCATGACTGGG - Intergenic
1194844580 X:98788874-98788896 CCTTCCATCTCAAAATGATAAGG - Intergenic
1197546590 X:127832650-127832672 GCTCCCATTACAAGATGCCATGG - Intergenic
1198944405 X:141994725-141994747 GCTCCCTTTTCCAGATGAGAAGG - Intergenic
1200518565 Y:4180161-4180183 GCCACCATCTCCAGATGAGAAGG + Intergenic
1202597927 Y:26562941-26562963 GCTAGCATCTCCAGATGAGAAGG - Intergenic