ID: 1002447892 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:179301247-179301269 |
| Sequence | AAAGATCTCAAGTTTCGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 20, 4: 195} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002447892_1002447899 | 15 | Left | 1002447892 | 5:179301247-179301269 | CCCAGCCGAAACTTGAGATCTTT | 0: 1 1: 0 2: 2 3: 20 4: 195 |
||
| Right | 1002447899 | 5:179301285-179301307 | CTCTGTCACTTGTGGCTATTTGG | 0: 1 1: 0 2: 1 3: 12 4: 185 |
||||
| 1002447892_1002447895 | 7 | Left | 1002447892 | 5:179301247-179301269 | CCCAGCCGAAACTTGAGATCTTT | 0: 1 1: 0 2: 2 3: 20 4: 195 |
||
| Right | 1002447895 | 5:179301277-179301299 | AATCCCCACTCTGTCACTTGTGG | 0: 1 1: 0 2: 3 3: 24 4: 172 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002447892 | Original CRISPR | AAAGATCTCAAGTTTCGGCT GGG (reversed) | Intronic | ||