ID: 1002447892

View in Genome Browser
Species Human (GRCh38)
Location 5:179301247-179301269
Sequence AAAGATCTCAAGTTTCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002447892_1002447895 7 Left 1002447892 5:179301247-179301269 CCCAGCCGAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1002447892_1002447899 15 Left 1002447892 5:179301247-179301269 CCCAGCCGAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG 0: 1
1: 0
2: 1
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002447892 Original CRISPR AAAGATCTCAAGTTTCGGCT GGG (reversed) Intronic