ID: 1002447894

View in Genome Browser
Species Human (GRCh38)
Location 5:179301252-179301274
Sequence AGTCTAAAGATCTCAAGTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002447894_1002447899 10 Left 1002447894 5:179301252-179301274 CCGAAACTTGAGATCTTTAGACT 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG 0: 1
1: 0
2: 1
3: 12
4: 185
1002447894_1002447895 2 Left 1002447894 5:179301252-179301274 CCGAAACTTGAGATCTTTAGACT 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002447894 Original CRISPR AGTCTAAAGATCTCAAGTTT CGG (reversed) Intronic