ID: 1002447895

View in Genome Browser
Species Human (GRCh38)
Location 5:179301277-179301299
Sequence AATCCCCACTCTGTCACTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002447894_1002447895 2 Left 1002447894 5:179301252-179301274 CCGAAACTTGAGATCTTTAGACT 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1002447893_1002447895 6 Left 1002447893 5:179301248-179301270 CCAGCCGAAACTTGAGATCTTTA 0: 1
1: 0
2: 3
3: 15
4: 125
Right 1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1002447892_1002447895 7 Left 1002447892 5:179301247-179301269 CCCAGCCGAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1002447895 5:179301277-179301299 AATCCCCACTCTGTCACTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002447895 Original CRISPR AATCCCCACTCTGTCACTTG TGG Intronic