ID: 1002447899

View in Genome Browser
Species Human (GRCh38)
Location 5:179301285-179301307
Sequence CTCTGTCACTTGTGGCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002447893_1002447899 14 Left 1002447893 5:179301248-179301270 CCAGCCGAAACTTGAGATCTTTA 0: 1
1: 0
2: 3
3: 15
4: 125
Right 1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG 0: 1
1: 0
2: 1
3: 12
4: 185
1002447892_1002447899 15 Left 1002447892 5:179301247-179301269 CCCAGCCGAAACTTGAGATCTTT 0: 1
1: 0
2: 2
3: 20
4: 195
Right 1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG 0: 1
1: 0
2: 1
3: 12
4: 185
1002447894_1002447899 10 Left 1002447894 5:179301252-179301274 CCGAAACTTGAGATCTTTAGACT 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1002447899 5:179301285-179301307 CTCTGTCACTTGTGGCTATTTGG 0: 1
1: 0
2: 1
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002447899 Original CRISPR CTCTGTCACTTGTGGCTATT TGG Intronic