ID: 1002451269

View in Genome Browser
Species Human (GRCh38)
Location 5:179320126-179320148
Sequence GTGGCCTCCCTTCCCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002451269 Original CRISPR GTGGCCTCCCTTCCCTCACC AGG (reversed) Intronic
900528002 1:3138540-3138562 GTGACATACCTGCCCTCACCTGG + Intronic
901061369 1:6473454-6473476 CTGACCACCCTTCCCTGACCAGG - Exonic
901322496 1:8348380-8348402 GTGGCATTCCTACACTCACCAGG + Intergenic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
902937273 1:19773304-19773326 GCTTCCTCCCTTCCCTCCCCAGG - Intronic
903675557 1:25062471-25062493 ATGGCCTCCCTTCTCTGCCCAGG - Intergenic
904052178 1:27646366-27646388 GAAGTCTCCCTTCCCTCCCCCGG + Intergenic
905472998 1:38207254-38207276 GTGGGTTCCCTGCCCTCCCCTGG + Intergenic
905489747 1:38334183-38334205 ATGGCCTCCCTTCCCCCATTAGG + Intergenic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
906321251 1:44818318-44818340 GTTGACTCCCTTCCATCAGCTGG - Intergenic
906677409 1:47703008-47703030 GAGCCCTCCCTGCCCCCACCTGG - Intergenic
908234656 1:62137840-62137862 GTGGCCTCCCTCACCTCAGGTGG + Intronic
911145121 1:94544123-94544145 GGGGCTTTCCTTCCATCACCAGG + Intergenic
911170787 1:94769087-94769109 GTTGCAGCCCTTCCATCACCAGG + Intergenic
912496868 1:110097503-110097525 GAGCCCTCCATTCCCTTACCAGG - Intergenic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
915994714 1:160550780-160550802 GTGGCATCACTTCCCTGACATGG + Intronic
917536648 1:175879046-175879068 GTAGCCTCCTTTCTCTTACCAGG + Intergenic
917722856 1:177802654-177802676 CTGGCCTCCTTTCCCTCCCCTGG + Intergenic
918151433 1:181800557-181800579 GGGGCCCTCCTTCCCCCACCAGG + Intronic
919518516 1:198557156-198557178 CCAGCCTCCCTTCCCTCTCCCGG - Intergenic
919750542 1:201034904-201034926 GTGGGCTCCCTTCTGTTACCTGG - Intergenic
919904271 1:202067268-202067290 GTGGCCTCACTCCCCACACCTGG - Intergenic
920053588 1:203177711-203177733 GGGGCCACCCTTCCCCCAGCCGG - Intergenic
920275941 1:204804350-204804372 GTGACCTTCCATCCATCACCTGG + Intergenic
921214373 1:212924681-212924703 CTGGCCTTCCTTCCTCCACCTGG + Intergenic
921379251 1:214506756-214506778 GAGGTCTCCCTCCCCTCACAGGG - Intronic
922620181 1:226984072-226984094 GTGACCTCCCTCCCCTACCCAGG + Exonic
922797661 1:228348935-228348957 GTGCCTTCCCATCCCTCACCCGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063565610 10:7170606-7170628 GTGGACTCGCACCCCTCACCTGG + Intronic
1066234593 10:33473074-33473096 GTGGCCTAGTTTCTCTCACCAGG - Intergenic
1067756720 10:49011219-49011241 GTGGCCTCCCTGCCCAACCCTGG - Intergenic
1069583140 10:69578605-69578627 GTGGCCTCCCCTCCCCCGCCGGG - Intergenic
1069638691 10:69941261-69941283 GTGGCCTCCCACCCCACACCTGG - Intronic
1069912096 10:71765914-71765936 CTGGCCTTCCCTCCCTCCCCAGG - Intronic
1070290046 10:75108209-75108231 GTGCCCTTCCTGCCCTCCCCAGG - Intronic
1070734296 10:78852771-78852793 GTAGCCCCCCACCCCTCACCAGG + Intergenic
1071508138 10:86245212-86245234 GTGTCCCCTCTTCCCTCCCCTGG - Intronic
1073328454 10:102656173-102656195 CTGGCCCCCCTGCCCTCCCCAGG - Intronic
1073403428 10:103277034-103277056 GATGCCCCCCTTCCCTCTCCCGG + Intergenic
1073921601 10:108466146-108466168 GTGGCCTCCTCTCCTGCACCTGG + Intergenic
1074527220 10:114272996-114273018 GTCCCCTCCCTTCCCTCCCATGG - Intronic
1075684458 10:124353989-124354011 GTGGCCTCCCATCTCCCTCCTGG + Intergenic
1075988132 10:126806237-126806259 ATTGCCTCCCTCCCCTCCCCAGG + Intergenic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1082810375 11:57476065-57476087 GTGCACCCCCTTCCCTCCCCCGG + Intronic
1083306802 11:61765758-61765780 TTCGCCTCCCTTCTGTCACCAGG + Intronic
1083331906 11:61902648-61902670 CAGGCCTCCCTTCCCCCACCCGG + Intronic
1083333297 11:61909059-61909081 TCGCCCTCCCTTCCCTCTCCAGG - Intronic
1083629536 11:64088488-64088510 CTAGCCTCCCCTTCCTCACCAGG + Intronic
1083755406 11:64789363-64789385 GGGGGCTCCCCTCCCTCCCCAGG + Exonic
1083771818 11:64871771-64871793 GTGGCCTCCCTCTCCCCTCCAGG - Intronic
1083848993 11:65354657-65354679 GTGGCGCCCCGTCCCTCCCCCGG - Intergenic
1084147361 11:67272179-67272201 CTGCCCTCCCGTCCCTGACCAGG - Intronic
1084175793 11:67421449-67421471 GAGGACTCCCTGCCCTCCCCAGG - Intronic
1084523893 11:69684175-69684197 GCTGCCTCACTTCCCTCTCCAGG - Intergenic
1085284584 11:75351569-75351591 GCGGCCGCCCTGCACTCACCGGG + Exonic
1085534936 11:77212046-77212068 GCTGCCCTCCTTCCCTCACCAGG - Intronic
1090278005 11:125432896-125432918 GGGGCTTCCCCTCCCCCACCTGG + Exonic
1090413976 11:126528219-126528241 GTGGCCTCTCCTCCCCAACCCGG + Intronic
1090626721 11:128614790-128614812 GTCGTCTGTCTTCCCTCACCAGG - Intergenic
1090988900 11:131798411-131798433 GTGGCCTCGCTTCCCCCAGAAGG + Intronic
1091278566 11:134369065-134369087 GTGGCCTCCCCTCCCTGCCCAGG + Intronic
1091405839 12:209029-209051 GTGACCTCTCTGCCCTCACCCGG + Intronic
1091534326 12:1391387-1391409 GAGGCCTTCCTACCCTAACCAGG - Intronic
1092829042 12:12426152-12426174 GTGGTCTCCCTTCCCTAGTCTGG + Intronic
1095741795 12:45615525-45615547 ATAGCCTCCCTTCCCCCTCCGGG + Intergenic
1096823857 12:54259361-54259383 ATGGCCTCCCCTGCCTCACCAGG + Intronic
1097228012 12:57490344-57490366 GTGACAGCCCTTCCCTCAGCGGG - Exonic
1097287665 12:57890026-57890048 CTGGCCTCCCCTGCCTCACCAGG - Intergenic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100870598 12:98906431-98906453 GTGGCATCTGTTCCCTCCCCAGG - Intronic
1101138686 12:101772650-101772672 GTGGCCTGCCTCCCAGCACCCGG - Intronic
1102925099 12:116820520-116820542 GTGTCCTCACTTCCCCCACCAGG + Intronic
1104025415 12:125022440-125022462 GTTTCCTCCCAACCCTCACCAGG - Intronic
1104581902 12:130016900-130016922 GTGGCCTCCCTGGACTCAGCGGG - Intergenic
1109090613 13:58039259-58039281 GTAGCCTCCCTTCCTTCATTTGG - Intergenic
1110225062 13:73110982-73111004 GGGTCCTTCCTTGCCTCACCTGG + Intergenic
1111691028 13:91563743-91563765 TTTGCCTCCCTTCCCTCCTCAGG + Intronic
1112506710 13:99980399-99980421 GTTGCCTCCCATTCCTGACCCGG + Intergenic
1113220065 13:108089964-108089986 GTGTCCTTCCTTGCCTCTCCTGG - Intergenic
1113552319 13:111202277-111202299 ATGACCTTCCTTACCTCACCAGG + Intronic
1114519132 14:23321817-23321839 CTCGCCCTCCTTCCCTCACCGGG - Exonic
1117670446 14:58100726-58100748 GTGGCACCCCTTCCTTCTCCTGG + Intronic
1118616288 14:67576500-67576522 GTGGCCACCCTTGCCTTACCTGG - Exonic
1119732056 14:76957206-76957228 GTGGCACACCTTCCCTCCCCTGG + Intergenic
1120210502 14:81629304-81629326 AACACCTCCCTTCCCTCACCTGG + Intergenic
1121469245 14:94139066-94139088 GGGGCCTCCGTTCCCTCAGTAGG - Intergenic
1121616826 14:95319352-95319374 GTCTCCTCCCCTCCCTAACCTGG + Intronic
1122416755 14:101553485-101553507 TCCACCTCCCTTCCCTCACCAGG + Intergenic
1122530795 14:102425288-102425310 GTGGCGTCCCTTCACTTACCTGG - Exonic
1122665687 14:103327942-103327964 TTTGCCTCTCTTCCCTCAGCTGG - Intergenic
1122960070 14:105090210-105090232 GAGGCCTCCCCGCCCTCTCCAGG - Intergenic
1123757999 15:23412028-23412050 ATGGCTTCCCCTCCCTCAGCCGG + Intergenic
1124416971 15:29480480-29480502 GTGGCCTCCCTGCCCTACCAGGG - Intronic
1124998420 15:34746513-34746535 ATGCCCTCCCTACTCTCACCAGG - Intergenic
1125323729 15:38515259-38515281 TGGGCCTCCATCCCCTCACCAGG + Intronic
1125501301 15:40241581-40241603 GTGCCGACCCTTCCCTGACCAGG - Intronic
1126574127 15:50181613-50181635 GTGTCCTGCCCTCACTCACCTGG + Intronic
1128583892 15:68830402-68830424 GTGGCCTGCTTTCCCCCACCTGG + Intronic
1129227000 15:74175897-74175919 GTGTCCTCACCACCCTCACCGGG - Exonic
1129503095 15:76059373-76059395 GTGCCATCCGCTCCCTCACCGGG + Intronic
1130767758 15:86889530-86889552 ATGCTCTCCCTTCCCCCACCTGG + Intronic
1132049648 15:98596453-98596475 GTGGTCTCCCTTGCTTCACAGGG + Intergenic
1132244010 15:100280560-100280582 CTGGCCCGCCCTCCCTCACCAGG + Intronic
1132252027 15:100341519-100341541 CTGCCTTCCCTTCCCTCGCCCGG + Intronic
1132306798 15:100820826-100820848 CTGGCCTCCCTTCTCTCCTCAGG + Intergenic
1133326940 16:4947603-4947625 AAGGCCTCCCCTTCCTCACCGGG - Intronic
1134080758 16:11323459-11323481 GGGGCCTCCCTTCCATCTTCTGG + Intronic
1134794293 16:17020506-17020528 CTGTCCTCCTTTTCCTCACCTGG + Intergenic
1135390171 16:22086009-22086031 GAGGCCTCGATTTCCTCACCTGG - Intronic
1135406222 16:22199845-22199867 GTGGCCTCCCCACCCTTGCCTGG - Intergenic
1135633170 16:24051893-24051915 ATGGTCTCCCTTTCCTGACCTGG - Intronic
1136518957 16:30784307-30784329 TTGGTCTCTCTTCCCTCCCCCGG + Intronic
1137392687 16:48094480-48094502 GTGGGCCCCCTTCTCACACCTGG - Intronic
1137729624 16:50680182-50680204 GTAGCTTCCCATCCCTCTCCAGG + Intronic
1137812278 16:51364258-51364280 GTGTCCTCCCTTCTCTCTGCAGG + Intergenic
1138349813 16:56340545-56340567 GTGACCTCACTGCCCCCACCTGG + Intronic
1138350005 16:56341443-56341465 TTGCCCTCGCCTCCCTCACCAGG + Intronic
1138517294 16:57543225-57543247 GTGGCCTCTCTTTCCCAACCTGG + Intronic
1138528344 16:57621392-57621414 GGCGCCTCCGTTTCCTCACCTGG - Intronic
1141194042 16:81846240-81846262 CTGGCCTCCCTTCCTTCAGGAGG + Intronic
1142138669 16:88462962-88462984 GGGGCCCCCCTCCCCTCCCCAGG + Intronic
1142138824 16:88463544-88463566 GTGGCCTCACGTCCTTCTCCCGG + Intronic
1143130221 17:4672949-4672971 GTGGGCTCCATGCCCTCAGCAGG - Exonic
1143135593 17:4710741-4710763 GTGGCCCCACCTCCCTTACCTGG - Exonic
1143148126 17:4789682-4789704 GTGGCCTCCCGCCCCCCAGCCGG + Intronic
1143733764 17:8896220-8896242 ATGGCCTCCCTGGCATCACCAGG - Intronic
1145996679 17:29108831-29108853 CAGGCCCCCCTTCCCTCACCCGG - Intronic
1147204232 17:38825147-38825169 CAGGCCTCCCTCCACTCACCAGG + Exonic
1150318955 17:64193732-64193754 GGGTCCTCACTTCCCTCAGCTGG + Exonic
1150743376 17:67797376-67797398 AGGGCATCCCTTCACTCACCTGG + Intergenic
1152011908 17:77724087-77724109 GAGGGCTCCCTTCCCTCCTCCGG - Intergenic
1152104487 17:78320938-78320960 GAAGCCTCCCTTCCCGGACCAGG + Intergenic
1152147955 17:78580515-78580537 GTGGCCTTCCTATCCTCACATGG - Intergenic
1152567431 17:81106558-81106580 CTGGCCTCCCTTCCTCCTCCTGG - Intronic
1154310577 18:13263437-13263459 GTGCCCTCACTGTCCTCACCAGG - Intronic
1155461781 18:26091136-26091158 TTGACCTCCCTCCCCTCTCCGGG - Intronic
1156376407 18:36518986-36519008 TTGGCCTCCCTTCCCCTCCCAGG - Intronic
1156475473 18:37403002-37403024 GTGGCATCTTTTCCCTCACTGGG + Intronic
1157681793 18:49613271-49613293 GGGGCCTGCCCTCCATCACCAGG - Intergenic
1157763533 18:50281819-50281841 GCGCCCTCCCTTCCCTCCCGCGG + Intergenic
1158247760 18:55451356-55451378 CTGGCATCCCTGTCCTCACCTGG + Intronic
1158849385 18:61479764-61479786 GAGCCCTCCCTCCCCTCACCTGG + Intronic
1159734024 18:72071724-72071746 CTTGCCTCCCTTCCCTTATCTGG - Intergenic
1160489580 18:79325920-79325942 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489590 18:79325961-79325983 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489609 18:79326043-79326065 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489620 18:79326084-79326106 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489631 18:79326125-79326147 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489641 18:79326166-79326188 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489651 18:79326207-79326229 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489661 18:79326248-79326270 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489671 18:79326289-79326311 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489690 18:79326371-79326393 GTACCCTCCCTCCCCTCACATGG + Intronic
1160489700 18:79326412-79326434 GTACCCTCCCTCCCCTCACATGG + Intronic
1160929081 19:1561240-1561262 GTGGCCTCGGCTCCCACACCAGG - Intronic
1160989114 19:1853399-1853421 CTGGCCTCCCCTCCTTCTCCTGG - Exonic
1161153450 19:2721071-2721093 GCCGCCTCCCCTCCCCCACCCGG - Intronic
1161614745 19:5263839-5263861 CGGGCCTCCCTTCCCCCGCCCGG - Intronic
1162372283 19:10286898-10286920 GGGGCCTCCCCTTCCTCTCCAGG + Intergenic
1162794150 19:13078111-13078133 GTGTGCTCCCTTCCCTAAACGGG + Intronic
1163561387 19:18021505-18021527 CTGCCCTAGCTTCCCTCACCCGG + Intergenic
1163616666 19:18333155-18333177 GAGTCCTGCCTTCCCCCACCTGG + Intergenic
1166066908 19:40365631-40365653 GTGGCCTCCCTGCCCTACACGGG + Intronic
1166382514 19:42362362-42362384 CTAGCCTGTCTTCCCTCACCAGG + Exonic
1166536843 19:43580070-43580092 GTCGCCTTTATTCCCTCACCAGG - Intronic
1167550864 19:50159797-50159819 TTGGCCTCACTTTCCTCATCTGG + Intronic
1167949564 19:53015433-53015455 CTGCCCTCCCCTCCCTCACATGG + Exonic
1167954135 19:53050597-53050619 CTGCCCTCCCCTCCCTCAACTGG + Exonic
1168245796 19:55112646-55112668 CGGCCCTCCCTTGCCTCACCTGG + Exonic
925440110 2:3878394-3878416 TAAGCCTTCCTTCCCTCACCTGG - Intergenic
925578491 2:5385130-5385152 GTGGCCTCCTCTCCCTGAGCTGG + Intergenic
926127811 2:10282743-10282765 GCCGACACCCTTCCCTCACCAGG + Intergenic
927869079 2:26612515-26612537 CTGGCCTCCCTCCCCTCCCAGGG + Intronic
928385198 2:30861467-30861489 TGGGCCTCCCTTTACTCACCTGG + Intergenic
928663862 2:33530799-33530821 GTGGTCCTCCTTCCCTCAACAGG - Intronic
932233556 2:70102692-70102714 GTGCGCTCACTTCTCTCACCCGG + Intergenic
932333847 2:70918169-70918191 GTGGCCTCCCTCCCCATCCCAGG - Intronic
933741800 2:85539487-85539509 GTCGCCGCTCTTCCATCACCCGG - Intronic
935112696 2:100106686-100106708 GAGACCTCCCGGCCCTCACCGGG + Intronic
935264700 2:101384441-101384463 TTGGCCTCCCCTCCAACACCGGG - Intronic
935289404 2:101597008-101597030 TGGGCCTCAGTTCCCTCACCTGG + Intergenic
935975154 2:108570822-108570844 TTGGCCTCCCTTTCCCCTCCAGG - Intronic
936812076 2:116413979-116414001 GTGGCAGCCCTGCCCCCACCAGG + Intergenic
942320312 2:174730476-174730498 GTGCCTTCCCTTCCCTAGCCAGG + Intergenic
946689781 2:222301415-222301437 GTGCCCTCCCACCCCTCTCCGGG - Intronic
948955615 2:241288110-241288132 GTGTCCTCTTTTCCCTCTCCAGG - Intronic
1170841914 20:19930624-19930646 GTGGCCGGCCCTCCCTCACAAGG + Intronic
1171464852 20:25320180-25320202 ATGGGCTCCTCTCCCTCACCTGG + Exonic
1172777526 20:37416163-37416185 GTGTCCTTCCTTCCCTCTCTGGG + Intergenic
1172836999 20:37879389-37879411 GGGGCCTCACTCCCCTCAGCTGG + Intergenic
1172876643 20:38168359-38168381 GTGCCCTGTCTTACCTCACCGGG + Intergenic
1172898633 20:38318002-38318024 ATGGCCAGCCTTCCCTTACCTGG - Intronic
1173226367 20:41164592-41164614 CTGGTCTCCCTTAGCTCACCAGG + Intronic
1173251421 20:41366071-41366093 CGGGCCTCCCTTCTCTCCCCTGG - Intronic
1175935989 20:62514256-62514278 CTGGGCACCCTTCCCTCCCCTGG - Intergenic
1179654523 21:42837185-42837207 CAGGCCTCCCTGCCATCACCCGG - Intergenic
1179712227 21:43269786-43269808 GAGGCCTCCCCTCCCTCTGCGGG - Intergenic
1180155536 21:45975467-45975489 GTCGCCTCCCTGCCCTACCCAGG - Intergenic
1180211072 21:46295772-46295794 GTGGCCTCCCTGCCCTAAGAGGG - Intronic
1180594193 22:16962922-16962944 TTGGCCTGCCCTTCCTCACCAGG - Intronic
1181032176 22:20153914-20153936 GAGGCCTCCCTTCCAAGACCTGG - Intergenic
1181284133 22:21739879-21739901 GTCTCCTCCCTTCCCTCCACTGG + Intergenic
1181511323 22:23389976-23389998 GAGGCCTCCCTTCCAAGACCTGG + Intergenic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1182739519 22:32557334-32557356 GTGGACTCCATCCCCTCACTGGG - Intronic
1182878701 22:33714697-33714719 GTGGCCTCCCTTGGCCCAACTGG + Intronic
1183361449 22:37385153-37385175 GAGGCCGCCCATCCCTCCCCGGG - Intronic
1183507905 22:38219719-38219741 GTGGCTTCCCTTCTCCCTCCAGG - Exonic
1183964258 22:41431889-41431911 GGGGCCTCCCTCCGCTCAACAGG + Intergenic
1184114538 22:42414713-42414735 GTGACCTCCATATCCTCACCCGG + Intronic
1184163277 22:42712158-42712180 GAGGCCACCCTTCCCTCCCAGGG + Intronic
1184301483 22:43563271-43563293 TTGGCCTCCCTGTCCTCACTGGG + Intronic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1185056573 22:48581861-48581883 GATGCCTCCCTCCCCTCTCCAGG - Intronic
1185276706 22:49953061-49953083 GTGGCCTCCCAGCCCTCAGGAGG - Intergenic
1185280574 22:49968211-49968233 CTGACCTCTCTTCCCACACCTGG - Intergenic
1185289809 22:50017635-50017657 TGGGCCTCCCCTCCCTCAGCAGG - Intronic
950309939 3:11948511-11948533 ATGACAGCCCTTCCCTCACCTGG + Intergenic
950525112 3:13518808-13518830 ATGCCCTCCCTCCCCTCAGCAGG - Intergenic
951711676 3:25590046-25590068 GGAGCCTCCCTTCCCTGCCCCGG - Intronic
952175377 3:30857123-30857145 GAGGCCTCCATTCACACACCTGG + Exonic
953357250 3:42265744-42265766 GGTGCCTCCCTTCCCTCCACCGG - Exonic
953398082 3:42588930-42588952 GTTACCTCACTTCTCTCACCGGG + Intronic
953462246 3:43090743-43090765 GTGGTCTCCCTTCCACCCCCTGG - Intronic
954414714 3:50387612-50387634 GAGGCCTCTCTCCCCTCACCAGG - Exonic
955549627 3:60070057-60070079 ATTGCCTCCATTCCCTCACAAGG + Intronic
956775657 3:72563285-72563307 GTGGCCTCCCCACCCTCCACCGG + Intergenic
957583279 3:82104277-82104299 CTGGCCCCCCATCCCTCAACAGG + Intergenic
961167860 3:124776046-124776068 CTGGCTTTCCTTCCCTCTCCTGG - Intronic
961217159 3:125168561-125168583 GTGGCCTCCCTGCCCACATCAGG + Intronic
961324303 3:126101175-126101197 TTGCCCTCCTTTCCCTCCCCGGG - Intronic
961661419 3:128470618-128470640 GGGCCCTGCCGTCCCTCACCGGG + Intergenic
962691979 3:137907814-137907836 GTGGCCACCCTTCCCCCATAGGG - Intergenic
963913998 3:150841152-150841174 GTGGGCTACATTCCCTCACCTGG + Intergenic
966244257 3:177788820-177788842 GTAGCTTGCCTTCCTTCACCTGG + Intergenic
966592567 3:181698478-181698500 GTGGCCACCAGTCCCTCACATGG + Intergenic
967574784 3:191077113-191077135 GTGGCAGCCCTCCCCTCTCCAGG - Intergenic
967862123 3:194160219-194160241 GTGCCCTCCCTTCCCTGTCCAGG + Intergenic
967955757 3:194876312-194876334 GCTGCCTCCCCTCCCTCCCCGGG + Intergenic
967974576 3:195025928-195025950 GGGGCCTCCCTCACCTGACCTGG - Intergenic
968681643 4:1925010-1925032 GGGGCCTCCCTTCCCTCCCCTGG + Intronic
968686351 4:1961796-1961818 GTGTCATCCCTTCCCTCACACGG + Intronic
968756182 4:2417663-2417685 ACGGCCTCCCTTCCCGAACCAGG - Intronic
968870537 4:3239780-3239802 GCTGCCTCCCTGTCCTCACCTGG - Intronic
969581779 4:8069442-8069464 GTGTCCTCCCTTGCGTCCCCTGG - Intronic
969588683 4:8109077-8109099 GCGGCCTCCCTTCCTTCCACGGG - Intronic
979494557 4:121369495-121369517 GTTTCCTCCCTTCCGTCACTGGG + Intronic
979832359 4:125317394-125317416 GAGGCGTGCCTTCCCTCACTGGG + Exonic
983847953 4:172542565-172542587 GAGGGCTCCCCTCCCCCACCAGG - Intronic
983948111 4:173608953-173608975 GTGCCCTCCTTTCCTTGACCAGG + Intergenic
985286749 4:188344172-188344194 GTGGCCTCCCTTCAGACACAGGG - Intergenic
985769233 5:1798772-1798794 GTGCGCTCACTTCTCTCACCCGG - Exonic
987263130 5:16223387-16223409 GTCAACCCCCTTCCCTCACCGGG + Intergenic
992104214 5:73436835-73436857 GCGGCCGCCCCTTCCTCACCCGG + Intergenic
997881669 5:137597525-137597547 ATTGGCTCCCTTCCCTCACAGGG - Intronic
999101040 5:149026615-149026637 GCAGCCTCCCTTCCATCTCCCGG + Exonic
1002165065 5:177338806-177338828 CTGGCCTCCCCCACCTCACCTGG - Intronic
1002451269 5:179320126-179320148 GTGGCCTCCCTTCCCTCACCAGG - Intronic
1002640007 5:180626265-180626287 CTGACCTCCCTTCCCTGGCCAGG - Exonic
1004252154 6:14031747-14031769 GTGGCTTCCCTTCCCGCCCCTGG + Intergenic
1004301784 6:14465160-14465182 GTGCCTTCCTTTCCCTTACCAGG + Intergenic
1004754833 6:18600322-18600344 CTGCCATCCCTTCCCTCACTAGG - Intergenic
1005232825 6:23724076-23724098 GTGGTCTCCTTACCCTCATCAGG - Intergenic
1005812799 6:29529719-29529741 TTGGCCTCCTTTTCCTTACCTGG + Intergenic
1006407896 6:33855847-33855869 CTCCCCTCCCTGCCCTCACCTGG - Intergenic
1006539387 6:34727196-34727218 GGGTCCTCCCTTCCCTCTCAAGG + Intergenic
1006742730 6:36320895-36320917 GTGGCCTCCCTGCCCCAGCCAGG - Intronic
1007697056 6:43740627-43740649 CCGGCCTCCCCTCCCCCACCAGG + Intergenic
1008466439 6:51836416-51836438 GGGGCATACCTTCCTTCACCCGG + Exonic
1011618049 6:89216079-89216101 GTGGCCTCCCTTAGCACCCCAGG + Intronic
1013512863 6:110859729-110859751 CGGGCCTCACTTTCCTCACCGGG - Intronic
1015963550 6:138675178-138675200 GTGGCTCCCCTTCCCTCTTCTGG + Intronic
1016091503 6:139984847-139984869 GTAGCCTGCTTTTCCTCACCTGG - Intergenic
1017906186 6:158758830-158758852 GTGGCCTCCCTTCCAGGACCCGG + Intronic
1019524580 7:1474984-1475006 GTGGCCTGCCTGCCCTCCCGAGG - Intronic
1019648709 7:2144679-2144701 GTAGCCTCCCTTCCCTTTCCGGG - Intronic
1020011790 7:4809270-4809292 GGGGCCCCCCTTCCATCACGAGG + Intronic
1020416954 7:7957417-7957439 GTTTCCTCACTTCCCACACCTGG + Intronic
1023875293 7:44283336-44283358 GGGGTCTCCCTGCCCTCACGGGG - Intronic
1027249472 7:76389997-76390019 GTGACCTCCCTTCCTCCTCCAGG - Exonic
1029364343 7:100107436-100107458 GTGGTCTCACTTCCCCCAACAGG - Exonic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1029535363 7:101154631-101154653 GAGGCCTCCCTTGCCTCGGCGGG + Intronic
1030141729 7:106311020-106311042 TTGGTATCCCTTCCCTCACTTGG + Intergenic
1031597554 7:123665531-123665553 GTCACCTCCCTTCCCTCACATGG - Intergenic
1032262544 7:130348568-130348590 GATGCCTCCCTTTCCTGACCAGG + Intronic
1034106881 7:148497778-148497800 GGGGCCTCCCCACCCTCCCCTGG - Intergenic
1035169164 7:157008428-157008450 GTGGTCACCCATCCCTCACCTGG - Intronic
1035219377 7:157396780-157396802 GTGGCCTCCCTGCCCCGAACTGG - Intronic
1035294067 7:157857970-157857992 AAGGGCTCCCTTCCCTCACAAGG - Intronic
1035422650 7:158742275-158742297 GTGGCCTGCCCTTCCACACCAGG - Intronic
1037855336 8:22367405-22367427 TTGGCGTCCCCGCCCTCACCTGG - Exonic
1041724412 8:61004749-61004771 GAGGCCTCCCTTCCTGCCCCAGG - Intergenic
1043401859 8:79891949-79891971 GTGGCCTCCCTTCCCCTCCCGGG + Intergenic
1043401883 8:79892006-79892028 GTGGCCTCCCTTCCCCTCCTGGG + Intergenic
1048019825 8:130527954-130527976 GTGAACTTCCTTCCCTGACCAGG - Intergenic
1048338267 8:133519104-133519126 CTGCCCTGCCTGCCCTCACCAGG - Intronic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1049205822 8:141363146-141363168 GGAGCCTCAGTTCCCTCACCTGG + Intronic
1049475133 8:142793804-142793826 TGGGCCTCTCTTCCCTCCCCTGG - Intergenic
1050352426 9:4753209-4753231 GTGTCATCCTCTCCCTCACCAGG - Intergenic
1051230180 9:14947900-14947922 GTCAACTCCCTTCCCTAACCTGG - Intergenic
1052051133 9:23850677-23850699 GGGGCTTCCCTCCCCTCTCCTGG - Intergenic
1055644034 9:78346199-78346221 CTGGAGTCCCTACCCTCACCGGG + Intergenic
1057198110 9:93126379-93126401 GTGGCCTGGCTGCCCCCACCTGG + Intronic
1057309477 9:93933179-93933201 GTTGTGTCCCTTCCCTGACCCGG + Intergenic
1058391369 9:104498944-104498966 GTGCCCACACTTGCCTCACCTGG + Intergenic
1059367831 9:113800485-113800507 GGGGCCTCTCTTCCCTTTCCAGG + Intergenic
1060058247 9:120434573-120434595 CTCGCCTCTCTTCTCTCACCTGG - Intronic
1060144430 9:121239303-121239325 GTGGATTGCCATCCCTCACCCGG - Intronic
1061597489 9:131641333-131641355 GTCGCCGCCCTCCCCTCCCCGGG + Intronic
1061653700 9:132070980-132071002 GTGGCTTCTGCTCCCTCACCAGG - Intronic
1062145049 9:134984504-134984526 GTGTCCTTCCTTCCCAGACCCGG + Intergenic
1062220161 9:135410716-135410738 AGGGTCTCCCTTCCCTCCCCTGG + Intergenic
1062280799 9:135750820-135750842 CTGGGCTCCCCTCCCACACCCGG - Intronic
1186740982 X:12517835-12517857 GTGGCCTCCCCTCCCCCAAGGGG + Intronic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1187623603 X:21086082-21086104 GTGGGCTCCCCTCTCTCCCCAGG - Intergenic
1193605874 X:83567316-83567338 GTGGCCACCCTTCCCTCTAGGGG + Intergenic
1196782890 X:119399278-119399300 GGGGCTTCCCGTCCCTCACGCGG + Exonic
1199699819 X:150366743-150366765 GGGGCCGCCCTGCCCTCTCCCGG + Intronic
1200077646 X:153559519-153559541 CCCGCCTCCCTTCTCTCACCTGG - Intronic
1200145546 X:153924563-153924585 GTGGCCACCCCGCCCTCACATGG - Intronic
1200210910 X:154346265-154346287 GTTGCTTCCCTTTCCTCTCCAGG + Intergenic
1200219942 X:154385827-154385849 GTTGCTTCCCTTTCCTCTCCAGG - Intergenic