ID: 1002451981

View in Genome Browser
Species Human (GRCh38)
Location 5:179324227-179324249
Sequence GCTTTAGTATGTTCACAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002451981_1002451983 6 Left 1002451981 5:179324227-179324249 CCATTCTGTGAACATACTAAAGC 0: 1
1: 0
2: 1
3: 19
4: 189
Right 1002451983 5:179324256-179324278 TTGAATTTTACGTTATAAGTTGG 0: 1
1: 0
2: 2
3: 29
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002451981 Original CRISPR GCTTTAGTATGTTCACAGAA TGG (reversed) Intronic
901323478 1:8353174-8353196 ACTTTAGTTTGTTCACAGGGAGG - Exonic
901336389 1:8452847-8452869 GCCTGAGTATCTTCACAAAAGGG - Intronic
909962465 1:81863399-81863421 GCTTTATGATGGTCCCAGAAAGG + Intronic
910999728 1:93150331-93150353 GGTTTAGTATGTCCACACCATGG - Exonic
912022649 1:105124776-105124798 ACTTTAGAATGCTCTCAGAAAGG - Intergenic
913690875 1:121278771-121278793 CCTTTACTAAGTTCATAGAAAGG + Intronic
914146665 1:145001192-145001214 CCTTTACTAAGTTCATAGAAAGG - Intronic
914701087 1:150134753-150134775 ACTGTGGTATGTTCACATAATGG - Intronic
914943848 1:152046567-152046589 GTTTGAGTATGTACACAGTATGG + Intronic
915157100 1:153886243-153886265 ACTTTACAATGTTCACACAACGG - Intronic
920478197 1:206297256-206297278 CCTTTACTAAGTTCATAGAAAGG + Intronic
921655626 1:217733116-217733138 ACTTTAGTATGATCATACAAAGG - Intronic
923349483 1:233089667-233089689 TATTTAGAATGCTCACAGAAGGG + Intronic
923475457 1:234327256-234327278 GTTTTAGTATATTCACAGAATGG - Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1069779726 10:70947270-70947292 GTTTTACTATGTTGTCAGAATGG - Intergenic
1070089003 10:73265506-73265528 ACTATAGTATATTCACATAATGG - Intronic
1071314165 10:84376561-84376583 GTTGTAGTATATTCACACAAAGG - Intronic
1075868079 10:125744691-125744713 GCTTTTGGATCTTCACAAAATGG + Intronic
1076203873 10:128579457-128579479 CCTTTAATAAGTTCACAGCAGGG - Intergenic
1078586544 11:12596023-12596045 GATATATTATGTTCACAGATTGG + Intergenic
1079824643 11:25175423-25175445 GCTTTGGTCTGGTCTCAGAATGG + Intergenic
1080136953 11:28866163-28866185 GCTTTAGTATCTTCTTAGAGAGG + Intergenic
1080879415 11:36305474-36305496 CTTTTAGTATATTCACAGATAGG - Intronic
1084160035 11:67343162-67343184 ATTTTAGTATATTCACACAATGG + Intronic
1085655895 11:78314538-78314560 GCTTTAGTATCTTAATATAATGG + Intronic
1086242495 11:84712220-84712242 AATAAAGTATGTTCACAGAAAGG - Intronic
1086969891 11:93069394-93069416 GATATAGTATGTTCACAGTCTGG + Intergenic
1088981236 11:114866068-114866090 GCTGTAGTATGCCCACAGGATGG + Intergenic
1089630470 11:119781148-119781170 GGATTAACATGTTCACAGAAAGG + Intergenic
1089748862 11:120636127-120636149 ACTGTAGTATATTCACACAACGG - Intronic
1090276411 11:125422842-125422864 GTATTTGTATGCTCACAGAAGGG + Intronic
1092595006 12:9992968-9992990 GCTTCTGTATATTCAAAGAAGGG + Intronic
1095961564 12:47838110-47838132 GCCTCAGTTTCTTCACAGAATGG - Intergenic
1096800645 12:54108206-54108228 GCTTCAGGATGTTCCCAGAATGG + Intergenic
1098376246 12:69818585-69818607 GGTGTAATGTGTTCACAGAATGG + Exonic
1098897177 12:76077108-76077130 ATTTTAATGTGTTCACAGAATGG + Intronic
1099307663 12:80978071-80978093 GCTTTAGCATATTCTTAGAAGGG - Intronic
1099451392 12:82811575-82811597 GCTTTAGTATTTTCAAAGGATGG + Intronic
1099793891 12:87371567-87371589 GATATAGTATATACACAGAACGG + Intergenic
1100686383 12:96990882-96990904 TCTCTAGGCTGTTCACAGAATGG + Intergenic
1101350452 12:103925511-103925533 GCTTAAGTGTGCTCACAGCATGG - Intergenic
1103727737 12:123006868-123006890 GTTTTAGTATATTCACAGCTGGG - Intronic
1106793564 13:33181475-33181497 CATTTAGTATGTTGACTGAATGG + Intronic
1107032048 13:35863167-35863189 ACTCTAGGATGTTCACACAATGG + Intronic
1108578904 13:51812076-51812098 GCTTGAGTAATTTCACAGACGGG - Intergenic
1110322868 13:74179794-74179816 GCTTTAATATGTCCTAAGAAAGG + Intergenic
1111945118 13:94656969-94656991 CCATTAGTATGCTTACAGAAAGG + Intergenic
1112243402 13:97704628-97704650 GCTTGAGTGTTTTCACAGCATGG + Intergenic
1115040265 14:28915925-28915947 GGTTTACTTTGTTCACAGCAAGG - Intergenic
1115748707 14:36465859-36465881 GCTTTAATATGTTCACAAGTTGG + Intergenic
1116177335 14:41488751-41488773 GCTTGAGTGTTTTCACAGTATGG - Intergenic
1116843345 14:49841803-49841825 GCTTAAAGATGTTCACTGAATGG + Intronic
1118778087 14:68986405-68986427 GATTTATTATGTTCACAGATTGG + Intergenic
1120680790 14:87478089-87478111 GCTTTAGTCTCTTCTTAGAATGG - Intergenic
1121584404 14:95052857-95052879 TCTTTATGATGTTCACACAATGG - Intergenic
1124828794 15:33127571-33127593 GCTTTAGGATGCTTACAGACTGG - Intronic
1128621995 15:69159143-69159165 GCCTTATTATGTTCCCAGACTGG + Intergenic
1129487964 15:75894890-75894912 GTTTTAGTACTTTCACAAAAAGG - Intronic
1130532265 15:84756515-84756537 GCTTTGGCATTTTCAGAGAAGGG + Intronic
1130783527 15:87070490-87070512 GCTTTGCTATGTTCACTGTAGGG - Intergenic
1131196358 15:90358454-90358476 GCTTTAAAATTTTCCCAGAATGG - Intronic
1131231101 15:90660227-90660249 GCTTGAGTATCTTCACAACATGG - Intergenic
1132100217 15:99017707-99017729 GGTTTTGTATGTAAACAGAAGGG - Intergenic
1133802798 16:9097732-9097754 GCTTCATTATGTTGGCAGAATGG + Intronic
1134191896 16:12128062-12128084 GCTTTTATATGTTTCCAGAAAGG - Intronic
1137945350 16:52728763-52728785 TCTTTCGCATGTTCACAGTAGGG + Intergenic
1139816347 16:69676893-69676915 AGTTTAGTATGTTAAAAGAAGGG + Intronic
1140636063 16:76915235-76915257 AATTTGGTATGTTCACACAATGG + Intergenic
1143858383 17:9869677-9869699 GCTTGAGTGTCTTCACAAAATGG + Intronic
1147490730 17:40863662-40863684 GCTTTGATACATTCACAGAAAGG - Intronic
1150020546 17:61607984-61608006 GCTTTAGTGAGTGCAAAGAAAGG - Intergenic
1150145280 17:62763953-62763975 GCTTTCAAAAGTTCACAGAAAGG + Intronic
1150549141 17:66192497-66192519 GCTGGAGGATGTTCACAAAAGGG + Intergenic
1150869893 17:68895711-68895733 GCTATAGTATCTTCACGGGAGGG + Intronic
1150957678 17:69878636-69878658 TTTTTAGTATTTTCACAAAATGG - Intergenic
1152103824 17:78317705-78317727 GCTTTAGGAAGTTCAGAGAGTGG + Intergenic
1154351567 18:13587820-13587842 GCTTTAGAATGTCTACAAAAAGG + Intronic
1155002665 18:21702484-21702506 GTTTTAATAAGTTCACTGAAAGG + Exonic
1155947448 18:31871754-31871776 GGTTTTGTATATTCACATAATGG - Intronic
1156040851 18:32820985-32821007 GGTCTAGTATATTCACACAATGG + Intergenic
1159629189 18:70729719-70729741 AATTTAGTATGTTCTCAGTAGGG + Intergenic
1161940911 19:7403253-7403275 TTTTTACTATGTTCACAGAGTGG + Intronic
1163965535 19:20743755-20743777 GTTTTAGTATGCTGACACAATGG + Intronic
1167144693 19:47674752-47674774 GCTTGAGTGTCTTCACAGCATGG + Intronic
1167399865 19:49257974-49257996 GCTATAGTATCTTCCCAGGAGGG + Intergenic
1168079635 19:54000027-54000049 GCTATAGTAGGTTCAAAGATGGG + Intronic
926323956 2:11768294-11768316 GTTTTAGTATATTTACAGATAGG + Intronic
926727592 2:16010494-16010516 CCTTCAGGATGTACACAGAAGGG + Intergenic
929145493 2:38703841-38703863 GTTTTTGTATTTTCACAGAGAGG - Intronic
929418559 2:41768265-41768287 GCTTTATTTTGTTCACAGCTGGG - Intergenic
929836985 2:45411357-45411379 GCTGTGGTATATTCACACAATGG + Intronic
930144676 2:47989873-47989895 TCTTTTCTATGTTCACAGAGTGG + Intergenic
930262074 2:49158827-49158849 GCTTTAGTATATTATTAGAAAGG - Intergenic
933134396 2:78713663-78713685 GCTTAAACATGTTCAGAGAAAGG - Intergenic
935561779 2:104567359-104567381 GCTTTGGTATTTTCAGAAAAGGG + Intergenic
936240618 2:110785639-110785661 GCTGTGGTATATTCACACAAAGG - Intronic
940421503 2:153484329-153484351 ATTATAGTATGTTCACATAATGG - Intergenic
941146665 2:161855515-161855537 GGTTTAGAATGGACACAGAAAGG + Intronic
941301554 2:163808808-163808830 ACTCTATTATGTTCACACAAGGG - Intergenic
941360944 2:164550743-164550765 ACTACAGTATTTTCACAGAATGG + Intronic
943723591 2:191230324-191230346 GCCTTAGTATCTTCACAACATGG + Intergenic
943934551 2:193899044-193899066 GCTTTAGTATTTACACAGTTGGG + Intergenic
944518270 2:200534561-200534583 GCTTTAGAATTTTCCCAGATTGG + Intronic
945103207 2:206282770-206282792 GTTTTATTATGTTCACAAAGTGG + Intronic
1169610489 20:7374385-7374407 ACTTTAGGATGTTCATACAAGGG - Intergenic
1171852420 20:30318006-30318028 GCTTCAGGATGTTCCCAGAATGG + Intergenic
1177061589 21:16381464-16381486 CATGTAGTATGTTCTCAGAAAGG + Intergenic
1177857518 21:26416133-26416155 GCTTTAGTAGGTAGAAAGAAAGG - Intergenic
1178334037 21:31728148-31728170 GCTTTAGCATTTTCAAGGAAGGG - Intronic
1181463727 22:23099708-23099730 TCTTTAGTACATTCACACAAGGG + Intronic
1184815615 22:46866895-46866917 CCTTTATTATGCTAACAGAACGG + Intronic
951470483 3:23051195-23051217 GCTTCAGTATCCTCACAGCATGG - Intergenic
951516860 3:23569415-23569437 TTTTTAGTATATTCACAGATTGG - Intronic
951630125 3:24710829-24710851 ACTTTAGTATTTTCAAGGAATGG - Intergenic
951907363 3:27718411-27718433 GCTTTAGATTTTTCTCAGAAAGG - Intronic
952433831 3:33252299-33252321 TTTTTAGTATATTCACAGATAGG + Intergenic
954475429 3:50740228-50740250 ATTTTGGTATGTTCACACAATGG - Intronic
955144063 3:56298791-56298813 GTTTTAGTATATTCACAAAGTGG - Intronic
955621231 3:60866411-60866433 GCTTGAGTAACTTCATAGAATGG - Intronic
957697770 3:83664745-83664767 GCGTTAGTATTTTCACAAAGGGG - Intergenic
961855110 3:129862304-129862326 TTTTTAGTATATTCACAGAGCGG - Intronic
962723359 3:138197021-138197043 GGTGTACTTTGTTCACAGAAAGG + Intronic
964340607 3:155705065-155705087 GCTTTATTCTGTGAACAGAAAGG - Intronic
964482377 3:157153975-157153997 GCTTTACTATTAACACAGAAGGG + Intronic
964862323 3:161216586-161216608 GCTTGAGTATGTACATTGAAAGG + Intronic
965435362 3:168644020-168644042 ATTGTAGTATATTCACAGAAGGG + Intergenic
967222762 3:187261853-187261875 ACTTTAGTATATTCATACAATGG + Intronic
968257125 3:197286002-197286024 ACTGTAGTATGTCCACACAATGG + Intronic
968332504 3:197883753-197883775 GCTCTTGTGTGTTCTCAGAAGGG + Intronic
970574127 4:17411331-17411353 TCTTTAGTATGTTTACTGATGGG - Intergenic
971253807 4:24995568-24995590 GCTTGAGTATGTTCAGAGCATGG + Intergenic
973234616 4:47886070-47886092 AATTTAGTATATTCACACAATGG + Intronic
975009878 4:69337774-69337796 GTTTTCGTATGTTATCAGAAGGG - Intronic
977251612 4:94694913-94694935 GGTATACTATGTTCACAGATTGG - Intergenic
978891768 4:113837401-113837423 TCTTTTGTATGTTCATATAATGG - Intergenic
979061878 4:116073164-116073186 ATTTTAGTCTGTTCACATAAAGG + Intergenic
982426943 4:155275342-155275364 GGTATACTTTGTTCACAGAATGG + Intergenic
983286666 4:165748626-165748648 GTTTTTAAATGTTCACAGAAAGG - Intergenic
983309385 4:166038291-166038313 CCTTTTGTATTTTCACAAAAGGG + Intronic
983325252 4:166246270-166246292 GCTGTTGTTTGTTTACAGAAAGG - Intergenic
983616859 4:169716166-169716188 GCTTTAGTAATTTTACAGAGTGG - Intronic
984708975 4:182869054-182869076 CTTTTAATATATTCACAGAATGG + Intergenic
985294060 4:188415876-188415898 ACTCTAGAATGTTCACACAAAGG + Intergenic
986949659 5:13067984-13068006 GATTCAGTATGGTCACAGAATGG - Intergenic
987247351 5:16061877-16061899 GCTCTAATATGTACAGAGAAGGG - Intergenic
987510178 5:18827324-18827346 CCTTTAAAATGTCCACAGAATGG - Intergenic
987670898 5:21007018-21007040 GCTTTGTTTTGTTTACAGAATGG - Intergenic
989438926 5:41447234-41447256 GCATTAATAAGTTAACAGAAAGG + Intronic
990349582 5:54902211-54902233 GCATTAGTAAGTTAGCAGAAGGG - Intergenic
992028805 5:72699755-72699777 GTTATAGTATGCTCACATAATGG - Intergenic
993196143 5:84748746-84748768 GCTATATTATTTTCACAGCAAGG + Intergenic
996626396 5:125575079-125575101 GCCTTATTATGTTCATAAAATGG - Intergenic
998512644 5:142726154-142726176 GTTTCAGTATATTCACAGGATGG + Intergenic
998943959 5:147317269-147317291 GCTGTAGTATTTTCACAGTCTGG - Intronic
1002451981 5:179324227-179324249 GCTTTAGTATGTTCACAGAATGG - Intronic
1004789053 6:19003850-19003872 ACTGTAGTATATTCACACAATGG - Intergenic
1008301631 6:49847878-49847900 GCTATAGTAACTCCACAGAATGG + Intronic
1009337284 6:62507259-62507281 GCTATAGTGTGTTCACAGGTTGG - Intergenic
1011104433 6:83763565-83763587 GTTTTATTAAGTTCAAAGAAAGG - Intergenic
1013800720 6:113938970-113938992 ATTTCAGTATGTTCACACAATGG + Exonic
1013953451 6:115813056-115813078 GCTTTACTAAATTCAAAGAATGG - Intergenic
1014181781 6:118392469-118392491 GTTTTAGTATATTCACAAGATGG + Intergenic
1015443689 6:133278177-133278199 GCTTTAATATCTTCCCAGAAGGG + Intronic
1015747075 6:136521569-136521591 GCTTTAGGCAGTTCACAGAATGG + Intronic
1020505752 7:8985744-8985766 GCTCTATGATGTTCACACAATGG - Intergenic
1021056740 7:16057934-16057956 GTTATAGTATATTCACACAAGGG + Intergenic
1025716891 7:63965896-63965918 GCTTTCCTGTGTTCACAGAATGG - Intergenic
1027820516 7:83037155-83037177 GCTATAGTATGATCACAAACTGG - Intronic
1028129122 7:87149511-87149533 GCTTAAGTATCTTCTCAGAAAGG + Intergenic
1028813646 7:95119233-95119255 TCTTTTATATATTCACAGAAAGG + Intronic
1030968490 7:116024011-116024033 GCTTCAGTTTGGTCAGAGAAAGG - Intronic
1033616219 7:143016987-143017009 GCTCTGGTATCTTCCCAGAAGGG + Intergenic
1034112097 7:148547165-148547187 GCTTTCATATTTCCACAGAAAGG + Intergenic
1039477972 8:37851020-37851042 ACTTTAGTATCATAACAGAAGGG + Intergenic
1039596723 8:38797118-38797140 GCTTGAGTATCCTCACAGCATGG + Intronic
1042041837 8:64599789-64599811 GTTTTATTTTCTTCACAGAAAGG - Intronic
1043418716 8:80077341-80077363 CCTTAAGGGTGTTCACAGAATGG + Intronic
1044055277 8:87561865-87561887 GCTTTGGTATATTCATAAAATGG - Intronic
1044211815 8:89559604-89559626 GCTTTAGTATTTTCTCTGTAAGG + Intergenic
1044891239 8:96838276-96838298 TCTTTTGCATGTTCACATAATGG + Intronic
1045886760 8:107107852-107107874 TCTTAAGTATGTGCAAAGAAAGG - Intergenic
1046287877 8:112119233-112119255 TTTTTAGTATATTCATAGAATGG - Intergenic
1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG + Intronic
1047101494 8:121681048-121681070 TCTTTAGTGTATTCACAGGATGG + Intergenic
1047914842 8:129571969-129571991 GCTTCACTCTGTTCACATAAAGG + Intergenic
1049587631 8:143439443-143439465 GCTGTAAAATGTTTACAGAAAGG + Intronic
1052311183 9:27071124-27071146 GCTGAATTATGTTTACAGAAGGG - Intergenic
1053311552 9:37023986-37024008 GCTTCAGAGGGTTCACAGAAGGG - Intronic
1053790206 9:41681285-41681307 GCTTCAGGATGTTCCCAGAATGG + Intergenic
1054154933 9:61633472-61633494 GCTTCAGGATGTTCCCAGAATGG - Intergenic
1054178548 9:61892974-61892996 GCTTCAGGATGTTCCCAGAATGG + Intergenic
1054474722 9:65564581-65564603 GCTTCAGGATGTTCCCAGAATGG - Intergenic
1054658982 9:67687850-67687872 GCTTCAGGATGTTCCCAGAATGG - Intergenic
1055089214 9:72345722-72345744 GCTCAAGTATCTTCACAGGAAGG + Intergenic
1056256805 9:84807860-84807882 TCTTTAGTCTGTCCACAGTATGG + Intronic
1057439284 9:95071027-95071049 GCTGTAGTATATTAACAGAAGGG + Intronic
1059086521 9:111308817-111308839 ACTTTGGTATGTTCACACAATGG + Intergenic
1059276420 9:113100907-113100929 GCTTTAGAATGTACTCAGAGAGG + Intergenic
1059642317 9:116229207-116229229 AGTTTGGTATGTTCACAGAGTGG + Intronic
1059931016 9:119261128-119261150 GCTTCAGTATCTTCAAAGACAGG - Intronic
1060432651 9:123563734-123563756 ACTTTATTATATTCACAGTAGGG - Intronic
1061054078 9:128212828-128212850 TCTTTGGTATATTCACAGAGTGG + Intronic
1186921239 X:14282941-14282963 ATTTTAGTATTTTCACACAATGG + Intergenic
1187468433 X:19546762-19546784 GCTATAGTATATTTACAGAATGG + Intronic
1190750107 X:53354762-53354784 GCCTTAGAATGTTCACACAAAGG + Intergenic
1193649928 X:84118619-84118641 GCTTTAGGGGGTTCAAAGAATGG - Intronic
1194910702 X:99640613-99640635 ATTCTAGTATGTTCACAAAATGG + Intergenic
1195134342 X:101889181-101889203 GGTTTCATATCTTCACAGAAAGG - Intronic
1197978054 X:132186287-132186309 GCTTTAATATATTCACAGTTAGG - Intergenic