ID: 1002452377

View in Genome Browser
Species Human (GRCh38)
Location 5:179326253-179326275
Sequence CCGCCAATACAGCATTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002452377_1002452387 18 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452387 5:179326294-179326316 TGGCCTCAGCCATGTCCTGAGGG 0: 1
1: 1
2: 1
3: 25
4: 316
1002452377_1002452390 26 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252
1002452377_1002452382 -10 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452382 5:179326266-179326288 GTATTGGCGGGAAGAGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1002452377_1002452386 17 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452386 5:179326293-179326315 TTGGCCTCAGCCATGTCCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 275
1002452377_1002452383 -2 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452383 5:179326274-179326296 GGGAAGAGCTAGAGGACCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 208
1002452377_1002452388 19 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452388 5:179326295-179326317 GGCCTCAGCCATGTCCTGAGGGG 0: 1
1: 0
2: 3
3: 21
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002452377 Original CRISPR CCGCCAATACAGCATTCCTG GGG (reversed) Intronic