ID: 1002452379

View in Genome Browser
Species Human (GRCh38)
Location 5:179326254-179326276
Sequence CCCGCCAATACAGCATTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002452379_1002452388 18 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452388 5:179326295-179326317 GGCCTCAGCCATGTCCTGAGGGG 0: 1
1: 0
2: 3
3: 21
4: 292
1002452379_1002452383 -3 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452383 5:179326274-179326296 GGGAAGAGCTAGAGGACCCTTGG 0: 1
1: 0
2: 2
3: 15
4: 208
1002452379_1002452387 17 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452387 5:179326294-179326316 TGGCCTCAGCCATGTCCTGAGGG 0: 1
1: 1
2: 1
3: 25
4: 316
1002452379_1002452386 16 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452386 5:179326293-179326315 TTGGCCTCAGCCATGTCCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 275
1002452379_1002452390 25 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002452379 Original CRISPR CCCGCCAATACAGCATTCCT GGG (reversed) Intronic