ID: 1002452390

View in Genome Browser
Species Human (GRCh38)
Location 5:179326302-179326324
Sequence GCCATGTCCTGAGGGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002452381_1002452390 24 Left 1002452381 5:179326255-179326277 CCAGGAATGCTGTATTGGCGGGA 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252
1002452377_1002452390 26 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252
1002452379_1002452390 25 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002452390 Original CRISPR GCCATGTCCTGAGGGGCTCT CGG Intronic
901912790 1:12474049-12474071 TCCATGTCATGTGGGGCTTTTGG - Intronic
903344119 1:22673536-22673558 GCCTTATCCTGAGGGACTCGGGG - Intergenic
904625358 1:31799308-31799330 GCCATGTTCTAAGGGCTTCTGGG - Intronic
907993714 1:59608235-59608257 GCCATGTCTCAAGGGGCTATGGG - Intronic
912473407 1:109921207-109921229 GCCAGGTCTTGAGGGCCTCGTGG - Intronic
914984069 1:152441522-152441544 GCCATGACGAGTGGGGCTCTGGG + Intergenic
915680812 1:157580682-157580704 GCCATGCCCAGAGGAGCACTGGG + Intronic
918380813 1:183953367-183953389 GCCTTCTCCTGAAGGGCTCTAGG + Intronic
922572955 1:226644571-226644593 GACATGTGCTCAGTGGCTCTGGG - Intronic
922899326 1:229123896-229123918 GGCATTTCCTGAGGGGCTGGAGG - Intergenic
1063614136 10:7587788-7587810 GACATGTGCTAAGTGGCTCTGGG + Intronic
1065875391 10:29993359-29993381 GCCCTGTCCTGGGGAGCGCTGGG - Intergenic
1066703419 10:38153347-38153369 TCCAGATCCTGAGGAGCTCTGGG - Intergenic
1066746098 10:38604926-38604948 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1066987363 10:42479876-42479898 TCCAGATCCTGAGGAGCTCTGGG + Intergenic
1067161269 10:43826637-43826659 GCCTTGTCCTGAGTGGCCTTAGG + Intergenic
1067214605 10:44292401-44292423 GCCTTGTCCTGAGTGGCCTTAGG - Intergenic
1067829289 10:49600968-49600990 GTCTTGTCATGAAGGGCTCTTGG - Intergenic
1068795915 10:61080167-61080189 GCTATATCCTAGGGGGCTCTTGG + Intergenic
1069104785 10:64370077-64370099 GCCATGTCCAGAAGGCCTCATGG - Intergenic
1069825476 10:71252830-71252852 GTCAGGTCCTGGGGGTCTCTGGG - Intronic
1070325892 10:75388815-75388837 GACATGCCCTGAGGGGCTCTGGG - Intergenic
1070655072 10:78265821-78265843 GCTATGCCCTGAGGTGGTCTTGG + Intergenic
1070724835 10:78780792-78780814 GCCCTGTCCTGAGTGTCCCTGGG + Intergenic
1071630816 10:87216799-87216821 GCTCTGTCCTGAGGGGTGCTGGG - Intergenic
1072560708 10:96571169-96571191 TCCAAGTCCTGAGTGTCTCTTGG - Intronic
1072610608 10:97014989-97015011 GCCTGGTCATGAGGGGCCCTGGG + Intronic
1074500372 10:114018095-114018117 TCCCTGTCCTGAGGAGCTCATGG - Intergenic
1076144080 10:128103105-128103127 GCCTTTTCCTTAGGTGCTCTTGG + Exonic
1076144169 10:128103822-128103844 GCCTTTTCCTTAGGTGCTCTTGG + Exonic
1076526429 10:131115265-131115287 GCCCTGCCCCGAGGGGCTCCAGG - Intronic
1076581288 10:131513612-131513634 GTCATGCCCCGAGGGGCTCCAGG + Intergenic
1076680773 10:132170137-132170159 GCCATGTCCTGAGGGATGGTGGG - Exonic
1076687608 10:132205103-132205125 CCCTTCTCTTGAGGGGCTCTTGG - Exonic
1076811806 10:132890245-132890267 GCCACGTACTGAAGGGGTCTGGG + Intronic
1082758475 11:57102288-57102310 GCCATGAACTCAGGGGCTCAAGG - Intergenic
1083175358 11:60946514-60946536 GCCAGGTAAGGAGGGGCTCTGGG - Exonic
1083956795 11:65988308-65988330 TACATGTGCTGAGGGGCCCTGGG + Intergenic
1084680387 11:70663189-70663211 GCCATGTGCTGACGGACTCTTGG + Intronic
1090182406 11:124711852-124711874 GCCAGGGCCTGAGGGGTTGTAGG - Intergenic
1091828935 12:3535574-3535596 GCCTTGTCCTGTTGGGTTCTTGG - Intronic
1091844211 12:3642911-3642933 GCCATACCTTCAGGGGCTCTGGG - Intronic
1092194550 12:6541422-6541444 GTCATTGCCTGAGGGTCTCTGGG + Intronic
1092529001 12:9328680-9328702 GCCAGGTCCTATGGGGCTGTGGG + Intergenic
1097154871 12:57005543-57005565 GCAATATCTGGAGGGGCTCTGGG - Intronic
1102587664 12:113934403-113934425 GCCATTTCCCCAGGGGCTCTAGG + Intronic
1103977621 12:124713683-124713705 GTCATCTCCTGATGGGCACTTGG - Intergenic
1104294069 12:127495854-127495876 GAAATGTCCTGTGAGGCTCTGGG - Intergenic
1105913199 13:24890452-24890474 GCCATGTCCTGAAAGCCTCTGGG + Intronic
1110487634 13:76065762-76065784 GTCATGTGCTGAAGTGCTCTGGG - Intergenic
1113607487 13:111620734-111620756 GCCCTCTCCTGGGGGGCTGTGGG + Intronic
1116618101 14:47163936-47163958 GCCATGTCCTCACTGGCTCGTGG + Intronic
1117989547 14:61420246-61420268 GCCAGGCCCAGAGTGGCTCTGGG - Intronic
1120854553 14:89201519-89201541 GCCAGGCTCTGAGGTGCTCTGGG - Intronic
1121358318 14:93232891-93232913 GCCACGTCCTCAGGGCCTCCCGG - Intergenic
1121447276 14:93987172-93987194 GCCCTGCCCTCAGGGCCTCTGGG + Intergenic
1122268158 14:100556384-100556406 ACCATGTCCTGGGGAGCCCTCGG + Intronic
1122494011 14:102139487-102139509 GCCCTGCCCTGAGGGGCGCCGGG - Exonic
1122718329 14:103708206-103708228 GCCAGAGCCTGAAGGGCTCTGGG + Intronic
1122896340 14:104759314-104759336 GTCATGTCCTGAGGTGTTCTGGG + Intronic
1123209066 14:106741292-106741314 GACATGTCCTGAGGTCCTCCTGG + Intergenic
1124848280 15:33311758-33311780 TCCCTGTCCTGCGGGGCTCGCGG - Intronic
1125612788 15:40983446-40983468 GCCATTTCTTGGGGAGCTCTGGG - Intronic
1128569114 15:68720571-68720593 CTCATGTCCTCAGGGGCTATTGG + Intronic
1128802351 15:70504859-70504881 GCCAGCTCCTGAGAGGCTCTGGG + Intergenic
1131258115 15:90874527-90874549 GCCATGTCCTGAGGGGGTGCGGG - Intronic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132105118 15:99057967-99057989 TCCATCTCCAGAGAGGCTCTTGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132826143 16:1906649-1906671 TTCGTGTCCTCAGGGGCTCTCGG - Intergenic
1132981315 16:2739896-2739918 CCCAGGTCCAGAGGGGCCCTGGG - Intergenic
1133569282 16:7025618-7025640 GGCATGTCCTGGGGGGGTTTTGG + Intronic
1133847513 16:9469128-9469150 GGCATGTCCAGAGGGTCTGTGGG - Intergenic
1136622827 16:31441816-31441838 GCCATGTACTGAGGTGTTCAAGG + Intronic
1136736960 16:32474715-32474737 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
1137720717 16:50625862-50625884 GCCATCTCCAGAGAGGCCCTAGG - Intronic
1137855371 16:51789555-51789577 GCCAAGGCCTGAGGAGCTCCAGG - Intergenic
1140482358 16:75268331-75268353 GCCATGTCTAGAGGGGCTGAGGG + Intergenic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141663180 16:85452707-85452729 GACCTGTGCTGAGGGTCTCTGGG - Intergenic
1142066795 16:88067472-88067494 GGCTTGTCCTGAGGGGCTCTAGG + Intronic
1142182151 16:88676555-88676577 GCCAGGTGCTGACGGGCCCTTGG - Intergenic
1203016111 16_KI270728v1_random:354862-354884 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1203034446 16_KI270728v1_random:628020-628042 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1142620488 17:1162514-1162536 GCCATGTGGTGAGGGCTTCTGGG - Intronic
1143588041 17:7861276-7861298 GGCATTTTCTGAGGGGCTTTGGG + Exonic
1143796664 17:9342472-9342494 GCTATGGCCTGAGGGGCAGTAGG + Intronic
1144022770 17:11251798-11251820 CCCCTGTCCTGAGGGGCACGTGG + Intronic
1145053340 17:19681264-19681286 GCCAAGTTCTGATGTGCTCTGGG + Intronic
1145309936 17:21695855-21695877 TCCATCTCCTGTGGGGCCCTGGG + Intronic
1148468152 17:47877308-47877330 GCCATGCCCTGAGAGGGGCTGGG + Intergenic
1148737560 17:49873340-49873362 CCCATCAGCTGAGGGGCTCTTGG + Intergenic
1150651119 17:67010808-67010830 GCCAGGTCCTGAGTAGTTCTGGG + Intronic
1152269663 17:79316602-79316624 GCCTTGTGGGGAGGGGCTCTGGG - Intronic
1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG + Intronic
1154303275 18:13213275-13213297 GCCCTGTCCTCAAGGGCTCCAGG - Intergenic
1155158524 18:23177669-23177691 GTCCTGTCCTGTTGGGCTCTGGG + Intronic
1156362857 18:36399640-36399662 GCCTTGTGCTCAGGTGCTCTAGG + Intronic
1157208850 18:45723727-45723749 GCAAGGGCCTGAGGGGCTGTTGG - Intergenic
1157563326 18:48663666-48663688 GCCAGGGCCTGAGGGGCTGGGGG - Intronic
1158566273 18:58556755-58556777 GCCCAGCCCTCAGGGGCTCTAGG - Intronic
1159679477 18:71329740-71329762 GCAATATCCTGAATGGCTCTGGG + Intergenic
1160826594 19:1083103-1083125 GCCAGGTGCTGAGCGGCTCCCGG - Intronic
1161738013 19:6003466-6003488 AGCATTTCCTGAAGGGCTCTTGG - Intronic
1163118443 19:15201314-15201336 GTCACGTCCTGAGAGGCTCATGG + Intergenic
1163836785 19:19579791-19579813 CCCATACCCTGATGGGCTCTGGG - Intronic
1163857402 19:19715329-19715351 GCCATGTCCTGAAGGACTCCAGG + Intronic
1165299562 19:34960249-34960271 GCCATGGCCAGAGGGGCTTATGG - Exonic
1166471605 19:43083509-43083531 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166482749 19:43187325-43187347 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166485223 19:43206459-43206481 GCCATGTCCCGCGGGGTTCCTGG - Intronic
1166492373 19:43270377-43270399 GCCATGTCCCGCGGGGTTCCTGG - Intergenic
1167663033 19:50807565-50807587 GCCTTGTGCTGGGGGACTCTGGG + Intergenic
1168204288 19:54837845-54837867 ACCATGTCCAGAGGGTCACTGGG - Intronic
1168505634 19:56932378-56932400 GCCCGGTCCTGAGGGAGTCTGGG - Intergenic
926220916 2:10934932-10934954 GCCCTGCCCTCAGGGGCTCATGG - Intergenic
926375335 2:12222036-12222058 CCCTAGTCCTGTGGGGCTCTTGG - Intergenic
927141501 2:20134297-20134319 CCCATGTCTTCAGGGGGTCTAGG - Intergenic
928167640 2:28982332-28982354 GCCATTTCCTCAGGAGCGCTGGG + Intronic
930091649 2:47535320-47535342 CCCATGTGCTGAGGTGCTGTGGG - Intronic
930828398 2:55717132-55717154 GCCAAGTCCTGAAAGGCACTGGG + Intergenic
932298219 2:70644307-70644329 TCCATGTCCTGCTGGGTTCTAGG + Intronic
932347748 2:71006797-71006819 GCCTTGCCCTGAGGCTCTCTGGG - Intergenic
932627474 2:73309052-73309074 GCCTCATCCTTAGGGGCTCTTGG + Intergenic
933721582 2:85400720-85400742 GCCATGTGCTGGGGGGGTCTTGG - Intronic
934188103 2:89763836-89763858 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
934308503 2:91844118-91844140 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
936042202 2:109158531-109158553 GTCATGTCCAGAGGCGCTCAGGG + Intronic
936227408 2:110669223-110669245 GCCGTGTGGTGAGGGCCTCTGGG + Intronic
937078607 2:119124888-119124910 GCCCTCTCCTGAGGTGCCCTGGG + Intergenic
937867687 2:126766380-126766402 GCCATGGCCTGTGGTGCTCCTGG + Intergenic
937872784 2:126797979-126798001 GGCCTCACCTGAGGGGCTCTGGG - Intergenic
938189504 2:129263136-129263158 GAGCTGTCCTCAGGGGCTCTTGG - Intergenic
938421870 2:131153020-131153042 ACAACGTCCTGAGGGGGTCTCGG + Intronic
939550383 2:143607905-143607927 GCCATGTGCTTAGTGACTCTGGG + Intronic
940153118 2:150624810-150624832 GGCAGGTCTTAAGGGGCTCTGGG - Intergenic
942036717 2:172017091-172017113 ACCAAGTCCAGAGGGGATCTGGG - Intronic
944207140 2:197168826-197168848 GCCATGTACTCATGAGCTCTAGG - Intronic
947750577 2:232529989-232530011 GGGCTGTCCAGAGGGGCTCTGGG - Exonic
1169142678 20:3235054-3235076 GCCATGTCCTGTGTGGGGCTGGG - Intronic
1169197059 20:3689001-3689023 CCTATCTCCTGAGGGGCTCCTGG + Intronic
1169722373 20:8692756-8692778 GCCATGTCCTTTGTGGATCTTGG - Intronic
1171409121 20:24934429-24934451 GCCAGGTTCTGTGGGGCTGTGGG - Intergenic
1172096572 20:32463420-32463442 GACATGTCCTGAGGGGCCTTGGG + Intronic
1173554826 20:43958606-43958628 GCCAGGTGCAGAGGGGCACTAGG - Intronic
1175380861 20:58562974-58562996 GCCATGACCTCCGGGGCTCATGG + Intergenic
1175806181 20:61830476-61830498 GCCAGGTCCTGGGGGGCCTTGGG - Intronic
1176267984 20:64220709-64220731 TCCACCTCCTGAGGGGCTTTGGG - Intronic
1176334527 21:5583638-5583660 GCCTTGTCCTGAGAGGGGCTTGG + Intergenic
1176393230 21:6237310-6237332 GCCTTGTCCTGAGAGGGGCTTGG - Intergenic
1176468189 21:7078864-7078886 GCCTTGTCCTGAGAGGGGCTTGG + Intronic
1176491750 21:7460642-7460664 GCCTTGTCCTGAGAGGGGCTTGG + Intergenic
1176508892 21:7677741-7677763 GCCTTGTCCTGAGAGGGGCTTGG - Intergenic
1176994879 21:15543820-15543842 ACCATGGGCTAAGGGGCTCTGGG + Intergenic
1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1179883397 21:44302816-44302838 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1180087932 21:45516368-45516390 GCCAGGTTCCGAGGGGTTCTTGG - Intronic
1180535590 22:16391197-16391219 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1180809824 22:18752022-18752044 ACCATGTCCAGAGAGGCTGTAGG + Intergenic
1180827080 22:18870911-18870933 ACCATGTCCAGAGAGGCTGTAGG - Intergenic
1181195967 22:21186274-21186296 ACCATGTCCAGAGAGGCTGTAGG + Intergenic
1181213561 22:21306850-21306872 ACCATGTCCAGAGAGGCTGTAGG - Intergenic
1181504452 22:23342514-23342536 ACCCTGTCCTGAGGAGCACTGGG + Intergenic
1181524250 22:23470161-23470183 ACCATGTCCAGAGAGGCTGTAGG - Intergenic
1181655568 22:24295126-24295148 ACCCTGTCCTGAGGAGCACTGGG + Intronic
1181709448 22:24672745-24672767 ACCCTGTCCTGAGGAGCACTGGG + Intergenic
1182557560 22:31137451-31137473 GCCAAGGCTTGAGGGCCTCTGGG + Intronic
1183313171 22:37122534-37122556 GCCATCCCCTCAGGGCCTCTGGG + Intergenic
1183348963 22:37324178-37324200 TCCTGGTGCTGAGGGGCTCTTGG - Intergenic
1183527761 22:38334224-38334246 GCCATCTTCAGAGGGGGTCTGGG - Intronic
1183688489 22:39375375-39375397 GCCTTGTCCTGAGCAGGTCTGGG + Intronic
1183781699 22:40003089-40003111 GCCAGGCCCTGGGAGGCTCTTGG + Intronic
1184093663 22:42305299-42305321 GCCATGCCCTGAGGGGGGCAGGG - Intronic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184895539 22:47404452-47404474 GTCATGTACTAAGGGGCTCTGGG - Intergenic
1185054886 22:48574515-48574537 GCCTGGCCCTGAAGGGCTCTTGG - Intronic
1203230834 22_KI270731v1_random:108567-108589 ACCATGTCCAGAGAGGCTGTAGG - Intergenic
950211134 3:11124430-11124452 GCCATTTACTGAGGGACCCTGGG + Intergenic
953782231 3:45881419-45881441 GGCAGCTCCTGAGGGGCACTTGG + Intronic
953869556 3:46614680-46614702 GCCATGCCCAGAGGAGCACTGGG - Intronic
955101534 3:55854608-55854630 GCCAGGTCCTTAGGGGATCTGGG - Intronic
959438661 3:106349503-106349525 GCCATGTTCGAAGGTGCTCTGGG - Intergenic
961051747 3:123752505-123752527 GCCATGTCACCTGGGGCTCTGGG + Exonic
961649589 3:128410763-128410785 GTCACTTCCTGAGGGGTTCTGGG - Intergenic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
962398984 3:135040973-135040995 GCCTTATCCTAAGGGGCTCCAGG - Intronic
962710771 3:138083898-138083920 GCCATCTCCTTAGGGGCTGCTGG - Intronic
968591353 4:1461229-1461251 GCCCTTTGCTGTGGGGCTCTGGG + Intergenic
970451310 4:16168833-16168855 GCTATTCCCTGAGGGGCACTGGG + Intronic
983277139 4:165631633-165631655 GCCATTACCAGAGAGGCTCTAGG + Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
990416608 5:55593052-55593074 GCCTTGTCCTTATGAGCTCTTGG - Intergenic
993504581 5:88694023-88694045 GCCATGTTCTAAGAGACTCTGGG - Intergenic
994195064 5:96913888-96913910 GCCACCTCCACAGGGGCTCTAGG - Intronic
995675244 5:114655819-114655841 CCCACCTCCTGAGGTGCTCTGGG - Intergenic
997468777 5:134105045-134105067 GCCATGCTCTCAGGAGCTCTCGG - Intergenic
998371765 5:141666450-141666472 ACCATGTCCTCAGGGGCTGGGGG + Exonic
1000518421 5:162269363-162269385 GCCATGTGCTGAGTGATTCTGGG + Intergenic
1002448656 5:179306877-179306899 GCCATGTCCTCAGAGCCTGTGGG - Intronic
1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG + Intronic
1003304048 6:4910468-4910490 GCCATGTCATGAGGTTCACTGGG + Intronic
1005508397 6:26490380-26490402 GCCCTGTCCTGAGGCTATCTAGG + Intergenic
1007176842 6:39902956-39902978 GCCCTCTGCTGAGGGGCTGTAGG - Exonic
1007707807 6:43801693-43801715 GCCACGTTCTGAGGGGAACTTGG - Intergenic
1007711246 6:43825729-43825751 TGCATGTCCTGAGGGGCTGGGGG + Intergenic
1011527662 6:88282586-88282608 GCCAGGTCGTGAGGGCCTCCTGG + Intergenic
1013844123 6:114428518-114428540 GCCATGTGCCTAGAGGCTCTTGG - Intergenic
1015543967 6:134343644-134343666 GCCCTGTCCTCAGAGGATCTAGG + Intergenic
1017811945 6:157989952-157989974 GCCTTGCCCTGGGGGGCACTGGG + Intronic
1018481904 6:164199505-164199527 GTAATTACCTGAGGGGCTCTAGG - Intergenic
1018838087 6:167500098-167500120 GCCCTTTCCTCAGGGCCTCTGGG - Intergenic
1019109505 6:169698614-169698636 GCCATGTTCTTAGTGGCTCCAGG - Intronic
1019615727 7:1959514-1959536 GGCTTGTCCTGATGTGCTCTGGG - Intronic
1019661031 7:2224145-2224167 GCCCTGCCCTCAGGGACTCTCGG + Intronic
1020697812 7:11437128-11437150 AGCCTGGCCTGAGGGGCTCTGGG + Intronic
1021092205 7:16496829-16496851 CCCATGACCTGTGGGGCTCATGG + Intronic
1021873103 7:25022838-25022860 CCCTTGTGCTGAGGAGCTCTTGG - Intergenic
1022487314 7:30789622-30789644 GGGATGTCCTGAGTGGCTTTGGG + Intronic
1022594290 7:31697224-31697246 GCGTTGTCCTGAAGTGCTCTGGG + Intronic
1023648574 7:42344729-42344751 GCCAAGAGCTGATGGGCTCTGGG - Intergenic
1023875010 7:44282168-44282190 GCCAGTTCCTGTGGGTCTCTGGG - Intronic
1031154549 7:118094633-118094655 GCCTGGTCATTAGGGGCTCTTGG + Intergenic
1031204864 7:118743824-118743846 TCCATGTCATAAGGTGCTCTTGG - Intergenic
1034498125 7:151433936-151433958 CCCGTGTCCTGGTGGGCTCTCGG - Intronic
1035353211 7:158261145-158261167 ACCATGTCCTGGGGTGCGCTGGG - Intronic
1035536649 8:396119-396141 TACTAGTCCTGAGGGGCTCTGGG - Intergenic
1038267381 8:26047397-26047419 GGCATGTCTTGAAGGGCTCACGG - Intergenic
1038347379 8:26744851-26744873 GCCACATCCTGAGGCTCTCTAGG + Intergenic
1040333388 8:46403832-46403854 GGAATGTCCTGAGGGCTTCTGGG - Intergenic
1043933183 8:86113845-86113867 GAAATGTGCTGAGGGGCTCCAGG - Exonic
1047026500 8:120830063-120830085 GCCATTTCCTCAAGGACTCTGGG - Intergenic
1047214426 8:122864941-122864963 GCCCTGCCCTCAGGGGCCCTTGG - Intronic
1049073467 8:140375065-140375087 GCTTTGTCCTGAGGCTCTCTGGG - Intronic
1049257399 8:141621234-141621256 GCCTTGGCCAGAGGGGCTCCGGG - Intergenic
1050733677 9:8738441-8738463 GCCATTTTCTAAGGGACTCTAGG - Intronic
1052549159 9:29925785-29925807 GACTTGTACTGAGGAGCTCTAGG - Intergenic
1054855320 9:69893113-69893135 CACATGCCCTCAGGGGCTCTGGG + Intronic
1056589474 9:87954296-87954318 GCCATGGCCTGGGAGGATCTGGG - Intergenic
1060878311 9:127099218-127099240 GAAATGTTCTGGGGGGCTCTTGG + Intronic
1061502829 9:131013555-131013577 CCCCTGTCCTGAGGGGCTCAGGG + Intronic
1061516293 9:131092459-131092481 GCCACGGCCTCAGGGTCTCTGGG - Exonic
1061865621 9:133490614-133490636 GCCACACCCTGAGGGGCACTGGG + Intergenic
1061940663 9:133882146-133882168 GCCATGCCCTGCAGAGCTCTCGG + Intronic
1062196938 9:135279619-135279641 GCCATGGCCACAGGGACTCTTGG - Intergenic
1062326163 9:136013525-136013547 GCCTTGTCCTCAGGGACTCCGGG + Intronic
1062354705 9:136156516-136156538 GCCCTGTGCTGTGGGGCTCCAGG + Intergenic
1062386035 9:136311882-136311904 GCTAGGCCCTGAGGGGCTGTGGG + Intergenic
1186198513 X:7133089-7133111 GCCATCTGCTGTGGGGCTTTCGG + Intronic
1186471411 X:9824891-9824913 GCCATCTCCTGCGGGACACTTGG + Intronic
1187228422 X:17397198-17397220 GCCATGCCGGGAGGGGCTCCTGG - Intronic
1187473434 X:19589233-19589255 GCCCTGCCCTCAGGGGCTGTCGG - Intronic
1190227173 X:48555222-48555244 GCCATGTCTAGAGTGGATCTTGG + Intronic
1194549378 X:95276966-95276988 GCCAGCTCCTGAGTGGCTTTTGG + Intergenic
1194579334 X:95652532-95652554 GCCATGTTGTGAGGGGACCTGGG + Intergenic
1195037232 X:100981195-100981217 ACCATGGCCTGAAGTGCTCTGGG - Intronic
1196519795 X:116660474-116660496 TCCTGGTCCTGAGTGGCTCTGGG + Intergenic
1198298681 X:135311835-135311857 GCCATGTCCTGAATGGACCTAGG - Intronic
1200117594 X:153776182-153776204 GGCATGCACTGAGGGCCTCTGGG - Exonic
1200243248 X:154508538-154508560 GCCGTGTCCTGAGGAGCACCTGG - Exonic
1202261919 Y:22979077-22979099 GCCATGCCTAGAGGGGCTATTGG + Intronic
1202281949 Y:23199011-23199033 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202283942 Y:23219508-23219530 GGCATGGACTGCGGGGCTCTGGG - Intronic
1202332425 Y:23768867-23768889 GCTACGTCCTCAGGGCCTCTGGG - Intergenic
1202414907 Y:24612818-24612840 GCCATGCCTAGAGGGGCTATTGG + Intronic
1202433621 Y:24813396-24813418 GGCATGGACTGCGGGGCTCTGGG + Exonic
1202435618 Y:24833894-24833916 GGCATGGACTGCGGGGCTCTGGG - Intronic
1202455878 Y:25057268-25057290 GCCATGCCTAGAGGGGCTATTGG - Intronic
1202538344 Y:25901196-25901218 GCTACGTCCTCAGGGCCTCTGGG + Intergenic