ID: 1002452390

View in Genome Browser
Species Human (GRCh38)
Location 5:179326302-179326324
Sequence GCCATGTCCTGAGGGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002452379_1002452390 25 Left 1002452379 5:179326254-179326276 CCCAGGAATGCTGTATTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252
1002452381_1002452390 24 Left 1002452381 5:179326255-179326277 CCAGGAATGCTGTATTGGCGGGA No data
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252
1002452377_1002452390 26 Left 1002452377 5:179326253-179326275 CCCCAGGAATGCTGTATTGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1002452390 5:179326302-179326324 GCCATGTCCTGAGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002452390 Original CRISPR GCCATGTCCTGAGGGGCTCT CGG Intronic