ID: 1002453696

View in Genome Browser
Species Human (GRCh38)
Location 5:179333404-179333426
Sequence GTACTTTTCAAAAGCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002453696_1002453706 28 Left 1002453696 5:179333404-179333426 CCTGTGTAGCTTTTGAAAAGTAC 0: 1
1: 0
2: 5
3: 31
4: 269
Right 1002453706 5:179333455-179333477 AAGCAGAATCTCTCAGGATGGGG No data
1002453696_1002453699 -2 Left 1002453696 5:179333404-179333426 CCTGTGTAGCTTTTGAAAAGTAC 0: 1
1: 0
2: 5
3: 31
4: 269
Right 1002453699 5:179333425-179333447 ACAGACCCCAGGGCTCACGCAGG No data
1002453696_1002453704 26 Left 1002453696 5:179333404-179333426 CCTGTGTAGCTTTTGAAAAGTAC 0: 1
1: 0
2: 5
3: 31
4: 269
Right 1002453704 5:179333453-179333475 TAAAGCAGAATCTCTCAGGATGG No data
1002453696_1002453703 22 Left 1002453696 5:179333404-179333426 CCTGTGTAGCTTTTGAAAAGTAC 0: 1
1: 0
2: 5
3: 31
4: 269
Right 1002453703 5:179333449-179333471 CTGATAAAGCAGAATCTCTCAGG 0: 1
1: 0
2: 2
3: 31
4: 283
1002453696_1002453705 27 Left 1002453696 5:179333404-179333426 CCTGTGTAGCTTTTGAAAAGTAC 0: 1
1: 0
2: 5
3: 31
4: 269
Right 1002453705 5:179333454-179333476 AAAGCAGAATCTCTCAGGATGGG 0: 1
1: 2
2: 17
3: 87
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002453696 Original CRISPR GTACTTTTCAAAAGCTACAC AGG (reversed) Intronic
904122683 1:28211595-28211617 GTCTTTTTCAGAAGCTTCACAGG - Intronic
904224255 1:29001690-29001712 GGCCTTTTCAAGAGCAACACTGG - Intronic
907724249 1:57004126-57004148 GTACTTTCCCAAAGCTATACAGG + Intronic
908518353 1:64916510-64916532 TTAATTTTCAAAAGCTAAAAAGG + Intronic
908914817 1:69114272-69114294 GTGCTTTTTACAAGCCACACAGG + Intergenic
909272447 1:73641051-73641073 GTACTATGCAAAAGTTACATGGG - Intergenic
910039792 1:82835965-82835987 GTACTTTATAATATCTACACGGG + Intergenic
912237030 1:107863441-107863463 GTACTTTTTAACAGATAGACAGG - Intronic
913028963 1:114878356-114878378 GTATTTTACAAAAGCTCCCCAGG - Intronic
913364312 1:118018730-118018752 CAACTTTTCAACAGCAACACTGG + Intronic
913978116 1:143481627-143481649 GTACTTTTGAAAAGTTCCTCTGG - Intergenic
914072520 1:144307256-144307278 GTACTTTTGAAAAGTTCCTCTGG - Intergenic
914106634 1:144659100-144659122 GTACTTTTGAAAAGTTCCTCTGG + Intergenic
915004742 1:152625571-152625593 GCACTTTTGAAATGCCACACTGG + Intergenic
917770331 1:178270113-178270135 GGACTTCTCAAAAGCAACACAGG - Intronic
918422689 1:184380124-184380146 CTAGTTTTCAAAAGCTATACTGG - Intergenic
918751883 1:188282338-188282360 GTACATTTCAAAATCGATACAGG + Intergenic
921227423 1:213034070-213034092 GTACCTGTCAAAAGATACAGAGG + Intergenic
921453440 1:215337842-215337864 GTAATTTTTAAAAGTTCCACAGG - Intergenic
923845712 1:237729319-237729341 GTGCTACTTAAAAGCTACACAGG + Intronic
1063349785 10:5343536-5343558 GGATTTCTTAAAAGCTACACAGG - Intergenic
1063890333 10:10622050-10622072 CTACTTTTGAAAACCCACACAGG - Intergenic
1064466542 10:15588232-15588254 GGACTTTTCAAAAGCATCATGGG - Intronic
1064468748 10:15613591-15613613 GTATTTTTCACAAGATACCCAGG + Intronic
1064997347 10:21307905-21307927 TTACTTGCCAAAAGTTACACAGG - Intergenic
1067816202 10:49478869-49478891 GTATTCTCCAAAAGCTACAAAGG + Intronic
1068685244 10:59864215-59864237 ATAATTTTCAAAAGCTACCTTGG + Intronic
1068928334 10:62563148-62563170 GTACTTTTCAAAAACTGCCTGGG + Intronic
1070971081 10:80567816-80567838 GCAGGTTTCAAAGGCTACACTGG - Intronic
1071853232 10:89597050-89597072 TTATTTTTAAGAAGCTACACAGG - Intronic
1072208819 10:93228114-93228136 GTCTTTTTAAAAAGCTACAAAGG + Intergenic
1072814527 10:98492086-98492108 GTAATTTGAAAAAGCTAAACAGG + Intronic
1073460567 10:103663534-103663556 GTACTTTTAAAAAGCTCCCTGGG - Intronic
1074133161 10:110601841-110601863 GTACTTTTCAAATGCTTCCTGGG - Exonic
1075412635 10:122240336-122240358 GTTCTTTCCAAATCCTACACAGG - Intronic
1079711076 11:23682368-23682390 GTATTTTTCAAAAGAAACATGGG - Intergenic
1079955651 11:26860932-26860954 GTAATTTTGAAAAGCTAAATTGG - Intergenic
1082079252 11:47999546-47999568 GTATTTTCCAAAAGCTTCTCAGG - Intronic
1087617663 11:100506864-100506886 GTACTTTTCATAAGCTTCTCAGG + Intergenic
1089608708 11:119657302-119657324 GTATTTTTAATAAGCTACCCAGG - Intronic
1090584604 11:128197402-128197424 GTACTTTTCACAAGCTACTTAGG - Intergenic
1091933079 12:4412960-4412982 GTATTTTTTAAAAGCCCCACAGG + Intergenic
1095564007 12:43599260-43599282 CTAATTATCAAAAGCAACACTGG + Intergenic
1096012484 12:48232002-48232024 GTATTTTTTAAAAGCTCCCCAGG + Intergenic
1098450831 12:70616586-70616608 GTATCTTTCAAAAGCTTCCCAGG + Intronic
1098478588 12:70935754-70935776 GTCCTTTTCAAACTCTAGACTGG + Intergenic
1099597674 12:84688481-84688503 GTTCTTTTTAAAAACTCCACAGG - Intergenic
1100120659 12:91365674-91365696 GTCTTTTTCAAAAACTATACAGG - Intergenic
1101094368 12:101321311-101321333 GTACATTTCAAAAGGTATAACGG - Intronic
1102415113 12:112754929-112754951 GTATTTTTTAAAAGCTTCCCAGG + Intronic
1103550349 12:121732540-121732562 GTACTTTTCTAATGTTCCACTGG - Intronic
1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG + Intergenic
1105221239 13:18329833-18329855 GTACTTTTGAAAAGTTCCTCTGG + Intergenic
1106482436 13:30147010-30147032 GTACTTTTCTAAAGCTTCCTAGG - Intergenic
1107510505 13:41079148-41079170 GCATTTTTCAAAAGACACACAGG + Intronic
1107893550 13:44935860-44935882 GGACTTTTCAAACACAACACAGG - Intergenic
1108881692 13:55127883-55127905 GTACTTTTCAAATGATTGACAGG + Intergenic
1110877371 13:80526838-80526860 GTACTATTTAAAAGATAAACTGG - Intergenic
1111811571 13:93098316-93098338 GTGCTTTTAAAAAGCTCCTCTGG + Intergenic
1112211965 13:97386919-97386941 GTACTTTTCTAAATCTTCAGTGG - Intronic
1113046328 13:106159203-106159225 ATATTTTTTCAAAGCTACACGGG - Intergenic
1113219929 13:108088177-108088199 GTCCCTTTCAAATGCTACCCTGG - Intergenic
1113412846 13:110105497-110105519 GTCCTTTTCAAGACCTACACTGG + Intergenic
1114039008 14:18658947-18658969 GTTATTTTTAAAAGCTCCACAGG + Intergenic
1115381680 14:32746581-32746603 GTACTTGTCAAGAGGTACAAGGG + Intronic
1121088546 14:91165225-91165247 GTAATTTTAAACATCTACACAGG + Intronic
1121190378 14:92023227-92023249 GTCATTTTCAAAAGCTCCACAGG - Intronic
1121668052 14:95687229-95687251 TTACTTTTCAAAAGCTCCCCAGG + Intronic
1123509370 15:20981107-20981129 GTAATTTTCAATAGCTAGTCAGG + Intergenic
1123566592 15:21554847-21554869 GTAATTTTCAATAGCTAGTCAGG + Intergenic
1123602853 15:21992140-21992162 GTAATTTTCAATAGCTAGTCAGG + Intergenic
1123905234 15:24914345-24914367 GTACCTTTCAAAAGATACCTGGG + Intronic
1123962839 15:25424194-25424216 TTACTTTTCTAAAGCTACACTGG + Intronic
1128412930 15:67417148-67417170 GCACTTTTCTAAACCAACACAGG - Intronic
1129953033 15:79608741-79608763 GCACTCTTCAACACCTACACGGG - Intergenic
1131558459 15:93419193-93419215 GTACTTTTCAAAATTTAAAATGG + Intergenic
1131796844 15:96027323-96027345 GAACTTGTGAAAAGCTAGACAGG - Intergenic
1132008802 15:98255919-98255941 GTACTTTTCAAAAGTCCCCCAGG - Intergenic
1202974953 15_KI270727v1_random:281942-281964 GTAATTTTCAATAGCTAGTCAGG + Intergenic
1133933634 16:10252031-10252053 GTCCTTTCCAAAAACCACACGGG + Intergenic
1135183454 16:20294629-20294651 GTACTTTTTAAAAGCCCCTCAGG + Intergenic
1135671596 16:24380375-24380397 GGACATTTAAAAAGCTATACAGG - Intergenic
1136357129 16:29752243-29752265 TTACTTATCAAAAATTACACAGG + Intergenic
1137899072 16:52245721-52245743 GTAATTTTAAAAAGCTCAACTGG + Intergenic
1139262973 16:65612873-65612895 GGTCTTTTTAAAAGCTCCACAGG - Intergenic
1140091248 16:71840956-71840978 TTACTTTTCAAAAGCTTTTCTGG - Intergenic
1140827736 16:78723267-78723289 GGAGTTTTCAAAAGCTTCCCAGG - Intronic
1142895796 17:2977863-2977885 GCTCTGTTCAAAAGCAACACTGG - Intronic
1144751409 17:17651122-17651144 GTACTTCTCAGCAGCAACACTGG + Intergenic
1146136859 17:30329767-30329789 GTACTTTTTAAAAGATCCCCTGG - Intronic
1146497026 17:33331926-33331948 CTATTTTTCAAAAGCTCCACAGG - Intronic
1146919289 17:36699243-36699265 GTATTTTTTAAAAGCTACCCAGG + Intergenic
1147362168 17:39937819-39937841 GGAATTTTCAAAAGCTCCTCAGG - Intergenic
1149033050 17:52105071-52105093 GTAATTTTAAAAAGCTTCTCAGG + Intronic
1149152097 17:53578900-53578922 ATACTTTTCAAAGGGTACATGGG + Intergenic
1149171515 17:53817300-53817322 GTACTTTGTAAAAGCTTCCCAGG + Intergenic
1149300051 17:55296913-55296935 GTACTTTTACAGAGCTCCACAGG + Intronic
1149770329 17:59315754-59315776 GTATTTTTCAAAAGCTTTCCAGG + Intergenic
1150203692 17:63383843-63383865 GTATTTTTGAAAAGCTTCCCAGG + Intronic
1150667802 17:67159996-67160018 GTACATATCAAAATCTACTCAGG + Intronic
1151269944 17:72986380-72986402 GTATTTCTAAAAAGCTTCACCGG - Intronic
1151635645 17:75345999-75346021 GCATTTTTCAAAAGCTCCTCTGG + Intronic
1152080141 17:78182071-78182093 GTATTTTTAAAAAGGTACAATGG + Intronic
1153114476 18:1638728-1638750 GTATTTTTAAAAATCTACCCAGG + Intergenic
1155948374 18:31881836-31881858 GTACTTCTCAAAAGATACACAGG + Intronic
1156670003 18:39457073-39457095 GGACTTTTCAAAAGCAACACTGG + Intergenic
1158455109 18:57599294-57599316 GTATTTTTTAAAAGCTCCCCAGG - Intergenic
1159561894 18:70004447-70004469 GTACTTTTTAAAAAATACTCTGG - Intronic
1159776057 18:72604074-72604096 GTACTTCTCAAAAGGTACAATGG + Intronic
1164672356 19:30079609-30079631 GGGCTTCTCAAAAGCTACCCAGG - Intergenic
1168487166 19:56773361-56773383 ATAATTTTTAAAAGCTATACAGG + Intergenic
925970297 2:9101971-9101993 GTAATTTTCCAATGCTCCACAGG + Intergenic
926884722 2:17586308-17586330 GTACATTTAAAAAGCAACTCAGG - Intronic
930336265 2:50050482-50050504 TCATTTTTCAAAAGCCACACTGG - Intronic
931911717 2:66906625-66906647 TAACTTTTCAAAAGCCACAGGGG + Intergenic
932210359 2:69923235-69923257 GTATGTTTCAAAAGCTCCCCAGG + Intronic
932962567 2:76431318-76431340 CTAGTTTTCAAAAGCTGCCCAGG + Intergenic
933485502 2:82917412-82917434 GTACTCTTCTAAAGATAAACTGG + Intergenic
933932131 2:87163635-87163657 GTACTTTTTAAAATGTACTCTGG - Intergenic
934018747 2:87921288-87921310 GTAATTTTTAAAAGCTTCCCTGG - Intergenic
934182821 2:89642635-89642657 GTACTTTTGAAAAGTTCCTCTGG - Intergenic
934293113 2:91716824-91716846 GTACTTTTGAAAAGTTCCTCTGG - Intergenic
935209801 2:100929475-100929497 GTATTTTTCAAAAGCTCTTCAGG - Intronic
935794025 2:106623077-106623099 GTCCTCTTGAAAAGGTACACCGG + Intergenic
935932025 2:108137590-108137612 GTATTTATCGAAAGCTAAACAGG + Intergenic
936360985 2:111801799-111801821 GTACTTTTTAAAATGTACTCTGG + Intronic
937104700 2:119299399-119299421 ATACTTTTCAAAATCTATATAGG - Intergenic
937203318 2:120219763-120219785 GCATTTTGCAAAAGCTGCACTGG + Intergenic
938922744 2:136009916-136009938 TTACATTTTAAAAGCTTCACAGG - Intergenic
938986301 2:136579681-136579703 GTACTTTTCAAAACCAAAAAGGG + Intergenic
939010666 2:136842257-136842279 ATAGGTGTCAAAAGCTACACAGG + Intronic
940092614 2:149937476-149937498 AGACTTTTCAACAGCAACACTGG - Intergenic
940516553 2:154691049-154691071 GTATTTTTCAGAAGCTCCACTGG - Intergenic
941039075 2:160600104-160600126 GTACTTTACAAAGGAGACACTGG - Intergenic
943670708 2:190657492-190657514 GTATTTTTCAAAAGCACCCCAGG + Intronic
943933313 2:193882904-193882926 GTACTTTTCAAAAGCCATACTGG - Intergenic
944353647 2:198759318-198759340 GAATTTTTAAAAAGCAACACAGG + Intergenic
944972544 2:205010677-205010699 ATACTTCTCAAAAGCCATACTGG - Intronic
946277185 2:218640429-218640451 GTACTTTCCAAAAGCTTCCCAGG - Intronic
1170552957 20:17492765-17492787 GTACTTTGGTGAAGCTACACAGG + Intergenic
1170916381 20:20630539-20630561 GTGCCTTTCATAAGCCACACAGG - Intronic
1171090506 20:22281641-22281663 GTATTTTTTAAAAGCTTCAGTGG + Intergenic
1171181263 20:23092386-23092408 GTATTTTTCAAAAACTTCCCTGG + Intergenic
1173271657 20:41542052-41542074 GTAGTTTCCAAAAACAACACAGG - Intronic
1173506805 20:43593863-43593885 ATTCTTTTAAACAGCTACACAGG - Intronic
1173743909 20:45421677-45421699 GTACCTCTGAAAAGCTACACAGG + Intronic
1175601634 20:60279106-60279128 GTATTTTTAATAAACTACACAGG - Intergenic
1176018154 20:62948388-62948410 GCACTTCTCAAAAGATACAGAGG - Exonic
1176729660 21:10480646-10480668 GTACTTTTGAAAAGTTCCTCTGG + Intergenic
1178724993 21:35043407-35043429 GAAATCTTCAGAAGCTACACTGG - Intronic
1179101377 21:38357954-38357976 GTCCTTTTCAAAAGCTCTTCAGG - Intergenic
1183950572 22:41350399-41350421 GTACTTTGCAAAAGTCACTCTGG + Intronic
949196778 3:1319338-1319360 TTACTTTTCTAAAGCTAAAGAGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
949563609 3:5225367-5225389 GATCTTTTCAATAACTACACTGG - Intergenic
951225517 3:20116533-20116555 GGACTTTTAAAAAGCTCCCCAGG + Intronic
951799844 3:26583583-26583605 GTAATTTTTAAAAGCTCCCCTGG + Intergenic
954029355 3:47807401-47807423 GGACTTTTAAAAAGCAAAACTGG + Intronic
955307085 3:57844542-57844564 GTATTTTACAAAAACTACCCTGG - Intronic
955782143 3:62496256-62496278 GTAATTTTTAAAAGCTGCCCAGG - Intronic
956308144 3:67849287-67849309 GTAGTTTTAAAAAGCTCCCCAGG - Intergenic
956772376 3:72537429-72537451 GTACTTTTTAAAATCTCCCCAGG - Intergenic
959373036 3:105553354-105553376 GCACTTTTAAAAAGTTTCACTGG + Intronic
962545244 3:136427716-136427738 GTATTTTGCAAAAGGTACAGTGG - Intronic
963177315 3:142313471-142313493 GTAGTTTTCAAATGCTCTACTGG - Intronic
963843049 3:150127712-150127734 GCATTTTTTAAAAGCTTCACAGG - Intergenic
964130941 3:153285746-153285768 TTACTTTTCCAAGGATACACAGG - Intergenic
964665900 3:159171683-159171705 GTAGGTTTTAAAAGCTCCACAGG + Intronic
965174354 3:165311941-165311963 GTCATTTTCAAAGGCTACAGAGG + Intergenic
966599519 3:181761364-181761386 GTATTTTTAAAAAGCTCCTCAGG + Intergenic
967064647 3:185904016-185904038 AAACTTTTCAAAAGCAACACAGG - Intergenic
967097670 3:186190656-186190678 TTATTTTTTAAAATCTACACAGG - Intronic
967802199 3:193674917-193674939 GTATTTTGACAAAGCTACACAGG + Intronic
967848112 3:194060150-194060172 GCATTTTTCAAAAGCTCCCCAGG + Intergenic
970388129 4:15577294-15577316 TTGCCTTTGAAAAGCTACACTGG - Intronic
971751694 4:30657805-30657827 GTTCTTTTCAAAAACTACTCTGG - Intergenic
972293454 4:37713916-37713938 GTAATTTTTAAATGGTACACTGG - Intergenic
974459740 4:62172138-62172160 GTACTTTTCATAATTTATACAGG - Intergenic
977720894 4:100239052-100239074 GTACTTTTAAATATCTACAAGGG - Intergenic
977757643 4:100692101-100692123 GTAGTTTTAAAAAGTTAAACAGG - Intronic
977856221 4:101897671-101897693 GGATGTTTTAAAAGCTACACAGG - Intronic
978739544 4:112121276-112121298 GTTCTTTTCAAAAGCTCTATTGG + Intergenic
982334115 4:154214741-154214763 GTTCTAATCAAAAGCAACACAGG + Intergenic
982808160 4:159792019-159792041 GTATTTTTCAAAAGCTTCCCAGG - Intergenic
983146692 4:164225102-164225124 GTACATTTCACAATCTACTCTGG + Intronic
983773372 4:171577351-171577373 GGACTTTTAAAAAGCTCCATGGG + Intergenic
983872561 4:172838780-172838802 GTATTTTTCAAAGGGTAAACAGG - Intronic
984550946 4:181158051-181158073 GTCCCTTTGAAAAGCTGCACAGG + Intergenic
985413932 4:189717797-189717819 GTCTTGTTCAAGAGCTACACTGG - Intergenic
988855395 5:35223420-35223442 GTAATTTTTAAAAGCTTCTCAGG + Intronic
989741099 5:44773208-44773230 ATACTTTTCAATAGTTAAACAGG + Intergenic
990150493 5:52811981-52812003 GTACATTTTAAAAGCTCCTCAGG + Intronic
990201589 5:53382100-53382122 GAACTTTTCAAATTCTAGACAGG + Intergenic
991435211 5:66591048-66591070 GTAGTTTTAAAAAGTTCCACAGG + Intergenic
991632180 5:68667172-68667194 GCAGTTTTAAAAAGCTACCCAGG + Intergenic
992466710 5:77013219-77013241 GTACATTTCAAAAGCTGCCCAGG - Intergenic
992758025 5:79927275-79927297 GGACTTTGCCACAGCTACACTGG + Intergenic
993126890 5:83846229-83846251 GTATTTTTGAAAAGTTACGCGGG - Intergenic
993924094 5:93844075-93844097 GGACTTTTCAATAGCAACAGAGG + Intronic
994099229 5:95876354-95876376 GCATTTTTCAAATGCTACAAAGG + Intergenic
995089558 5:108157782-108157804 GAACTTTTAAAAAGCTAAACTGG - Intronic
995423933 5:111998146-111998168 GTACTTTTCAAAGGCTTCACAGG + Intergenic
995648194 5:114337394-114337416 GTTCTTTTCACTAGCTACATGGG - Intergenic
997029667 5:130111695-130111717 GTAATTTTTAAAAGCTTCCCAGG + Intronic
999573347 5:152945675-152945697 GTACTATCCAGAAGCTCCACTGG + Intergenic
1000390819 5:160721474-160721496 TTAATTTTCAGAAGCTTCACTGG - Intronic
1001311022 5:170611019-170611041 TGACTTTTCAAAAGTCACACAGG + Intronic
1002054906 5:176593297-176593319 GTATTTTTCAAGAGCTCCTCAGG - Intronic
1002453696 5:179333404-179333426 GTACTTTTCAAAAGCTACACAGG - Intronic
1002771805 6:296544-296566 GGAGTTTTCAAAGGCTCCACAGG - Intronic
1004162499 6:13227313-13227335 CTAGTTTTCTAAAGCTACACAGG - Intronic
1004230254 6:13826692-13826714 GTACTTTCAAAAATCTACACGGG - Intergenic
1004848392 6:19670934-19670956 CTCCTTTTCATAAGCTACCCAGG - Intergenic
1004915718 6:20330165-20330187 GTAATTTTTAAAAGATACCCTGG + Intergenic
1006841154 6:37028487-37028509 GTACTCTTTAAAAGCTCCCCAGG - Exonic
1006989804 6:38205364-38205386 AAATTTTTCAAAAGCAACACTGG + Intronic
1007632166 6:43278531-43278553 GTATTTTTAAAAAGCAACTCTGG + Intronic
1008572762 6:52830839-52830861 GTATTTTAGAAAAGCTACGCTGG + Intergenic
1008971030 6:57368343-57368365 GTAATTTTAAAAAGCTTCACTGG + Intronic
1009159992 6:60270161-60270183 GTAATTTTAAAAAGCTTCACTGG + Intergenic
1010688855 6:78884500-78884522 GTACTTTTCTAAAACCAAACTGG + Intronic
1011925429 6:92638032-92638054 ATACTTTTAAAAAGCTAGAAGGG + Intergenic
1012141734 6:95633867-95633889 GAACTTTTCAAAAGTAACACTGG - Intergenic
1012659091 6:101863754-101863776 AAACTTTCCCAAAGCTACACAGG - Intronic
1013581086 6:111535307-111535329 GCACTTTTCATAAGATTCACTGG + Intergenic
1013609726 6:111783125-111783147 GTGCTTGACAAAAGATACACAGG - Intronic
1014444330 6:121509380-121509402 TAACTTTTCCAAAGCAACACAGG - Intergenic
1014495820 6:122120913-122120935 CTACTTTTAAAAAGTTACATGGG - Intergenic
1015206752 6:130649324-130649346 GGTCTTTTCAAAAGATTCACTGG - Intergenic
1016016070 6:139187622-139187644 GTACTTACCAAAAGTTACTCAGG - Intergenic
1016799084 6:148150367-148150389 GGACTTTTCAATAGCAAGACTGG - Intergenic
1017659283 6:156658093-156658115 GTGCTTTTCTAAAACTACACAGG + Intergenic
1020210701 7:6156048-6156070 GTATTTTTAAAAAGCTAAATTGG + Intronic
1020413468 7:7918461-7918483 ATACTTTTCAAGAGCTATATCGG + Intronic
1021256121 7:18394493-18394515 GTACTTTTTAAGAACTCCACAGG - Intronic
1022409300 7:30125104-30125126 GTGATTTTCAAAGGATACACTGG - Intronic
1022527712 7:31049251-31049273 GTATTTTTTAAAAGCTCCCCGGG + Intergenic
1022892065 7:34711631-34711653 GTACTTTTCCAGAGCTTCCCAGG + Intronic
1022975876 7:35556628-35556650 GTACTTTAAAAAATCCACACTGG - Intergenic
1023320178 7:38988337-38988359 GTATTTTTAAAAAGCTTTACAGG + Intronic
1023576022 7:41627824-41627846 GTATTTTTCAAAAGGTCCCCAGG + Intergenic
1024279019 7:47703038-47703060 CAACTTTTCAAAGGCAACACTGG - Intronic
1027145838 7:75693875-75693897 GAACTTTTCAAGAGCCACACTGG - Intronic
1027713827 7:81643701-81643723 GTAATTTTTAAAAGATACTCAGG + Intergenic
1027889268 7:83950206-83950228 TTACTTTTGAAAAGCTAAATAGG + Intergenic
1028092604 7:86722108-86722130 GTACTTTTCAGAAGCCTCTCTGG - Intronic
1028952090 7:96647932-96647954 GTAATTTTCAAAAATTTCACTGG - Intronic
1032913539 7:136461478-136461500 ATATTTTTCAAAAGCTTCCCAGG - Intergenic
1033221853 7:139532126-139532148 AGACTTTTCAAAAGCAACACTGG + Intronic
1034599922 7:152240927-152240949 GTACTTTTGAAAAGTTTCTCTGG - Intronic
1036728941 8:11244871-11244893 GTATTTTTCAAAAGTTGCCCAGG + Intergenic
1038226550 8:25663408-25663430 GCAATTTTCAAAAGACACACAGG - Intergenic
1038996443 8:32928247-32928269 GTAGTTTTCAAAAGCTCCCTTGG - Intergenic
1039378666 8:37063724-37063746 GTAATTTTCAAATGTTTCACTGG - Intergenic
1042304904 8:67321385-67321407 GTATTTTTAAGAAGCTCCACGGG + Intronic
1043910901 8:85862891-85862913 GTATTTTTTAAAAGCTTCTCAGG + Intergenic
1044018822 8:87078743-87078765 TAACTTTTCAAAAGCTATTCAGG + Intronic
1044298294 8:90553963-90553985 GTCCTTTTTAAAAGCTTCTCAGG + Intergenic
1044737071 8:95289856-95289878 GTACTTATGAAGAGCTAGACTGG - Intergenic
1046214847 8:111130878-111130900 GTACTTTACCAATGCCACACAGG - Intergenic
1046402634 8:113724830-113724852 GTACTTTTTAAAAATTAAACAGG - Intergenic
1047083563 8:121491790-121491812 GTACTTTTCAGAAGATACAGGGG - Intergenic
1047162328 8:122394502-122394524 GCATTTTTTAAAATCTACACAGG + Intergenic
1048454025 8:134561587-134561609 GTACTTTTAAAAGGCAATACAGG + Intronic
1049309797 8:141927761-141927783 GGGCTTTTCACAAGCTGCACTGG + Intergenic
1051107017 9:13592063-13592085 ATACTTTTCAAGATATACACTGG - Intergenic
1051204824 9:14675388-14675410 GTATTTTTAAAAAGCTCCCCAGG - Intronic
1051310384 9:15764813-15764835 CTATTTTTAAAAAGCTCCACAGG - Intronic
1051345426 9:16146954-16146976 GTATTTTGCAAAAGCTGCAAGGG + Intergenic
1051590103 9:18769053-18769075 GTACTTTTTAAAAGCTCCCCAGG + Intronic
1052303697 9:26981719-26981741 GAACTTTTAAAATGCTACAAGGG - Intronic
1052415224 9:28169429-28169451 ATACTTTACAAAAGCAAAACCGG + Intronic
1054819070 9:69504079-69504101 GGACTTTTCACAAGCAATACTGG - Intronic
1055639597 9:78309239-78309261 GTTCTTCTCCAAAGCTGCACTGG - Intronic
1057150114 9:92789222-92789244 CTACTTTCCAAAATCTAGACAGG - Intergenic
1057825396 9:98369094-98369116 GTAGTTTTCAAAAGGTCCTCTGG + Intronic
1058377365 9:104338968-104338990 GTATTTTTAAAAAGCTCCCCAGG - Intergenic
1059609927 9:115881677-115881699 GTAGTTTTTAAAAGCTCCCCAGG - Intergenic
1059676950 9:116548858-116548880 GTACTTTTCAGAAGCTCAATAGG + Intronic
1059874120 9:118614535-118614557 GTACTTTCCAAAGGTAACACAGG + Intergenic
1203584614 Un_KI270746v1:53428-53450 GTACTTTTGAAAAGTTCCTCTGG - Intergenic
1186080997 X:5931715-5931737 CTACTTTTGAAAAACTACAGAGG + Intronic
1186892042 X:13968476-13968498 GTACCTTTCAAAAGCTCCCCAGG - Intergenic
1187439078 X:19301451-19301473 GTGCTTTTTAAAAGCTCCCCAGG - Intergenic
1187439091 X:19301538-19301560 GTATTTTTGAAAAGCTCCCCAGG + Intergenic
1187631808 X:21181458-21181480 GTACTTTTAACAAGCTACCCAGG - Intergenic
1187934584 X:24323076-24323098 GTAACTTTCAAAAGCTTCCCAGG + Intergenic
1187982743 X:24776020-24776042 GTACTTTCTAAATGCTACAGTGG - Intronic
1187988626 X:24844443-24844465 CTTCTTTTTAAAAGCTACATTGG + Intronic
1188678815 X:32976406-32976428 CTACTTTTCAAAAGCTGAATAGG - Intronic
1188688424 X:33098874-33098896 GAACTTTTCAAAAGAGACAAAGG + Intronic
1189271815 X:39757438-39757460 GCACTTTTCACAAGCTCCCCAGG - Intergenic
1190742431 X:53298441-53298463 GGACTTATCAACAGCAACACTGG - Intronic
1192404510 X:70870879-70870901 GTATTTTTCACAGGCTTCACAGG + Intronic
1192568991 X:72186975-72186997 TTACTTTTCATAAGCAAGACTGG - Intronic
1193427251 X:81354979-81355001 CTACTTTGCAGAAGCAACACAGG + Intergenic
1193926480 X:87492026-87492048 GTATTTTGTAAAAGTTACACTGG - Intergenic
1196117650 X:112014849-112014871 GTATTTTTTCAAAGCTACCCAGG - Intronic
1196495035 X:116314718-116314740 GTAGTTTTAAAGAGCTCCACAGG - Intergenic
1198003464 X:132465517-132465539 ATATTTTTTAAAAGTTACACTGG + Intronic
1198282133 X:135152867-135152889 TTCCATTACAAAAGCTACACTGG + Intergenic
1198284433 X:135175852-135175874 TTTCATTACAAAAGCTACACTGG + Intergenic
1198288826 X:135219655-135219677 TTCCATTACAAAAGCTACACTGG - Intergenic
1198728945 X:139706742-139706764 GAACTTCTCAATAGCAACACTGG + Intronic
1198992091 X:142526402-142526424 GTACTTTGAAAAAGCTGCCCAGG - Intergenic
1199125783 X:144117848-144117870 GTAATTTTTAAAAGCTTCCCTGG + Intergenic