ID: 1002454983

View in Genome Browser
Species Human (GRCh38)
Location 5:179340875-179340897
Sequence CCACGCTGCCCAGGAGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002454979_1002454983 -1 Left 1002454979 5:179340853-179340875 CCACGTGAAATTAGCACGCCTAC 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG 0: 1
1: 0
2: 1
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002454983 Original CRISPR CCACGCTGCCCAGGAGATAC TGG Intronic
900033818 1:390555-390577 CCAGGCTGCCCAGGAGAATGTGG + Intergenic
900054653 1:620445-620467 CCAGGCTGCCCAGGAGAATGTGG + Intergenic
900458248 1:2787597-2787619 CCAGGCGGCCCAGGCGGTACAGG + Exonic
901390551 1:8943193-8943215 GCACACTGCCAAGGACATACTGG - Intergenic
904160518 1:28519068-28519090 CCACCCTGCCCAGGAGGCTCAGG + Intronic
906225594 1:44118976-44118998 CCAGGCTGCCCAGGTGAGTCAGG + Exonic
908847543 1:68340014-68340036 CTACGCTGCCCACCACATACAGG + Intergenic
913427682 1:118752404-118752426 CCATTCAGCCCAGGAGATACTGG + Intergenic
915066062 1:153225075-153225097 CCAGGCTGCCCAGGGAATACAGG + Intergenic
915178610 1:154038630-154038652 CCACCATGCCCAGCAGACACAGG + Intronic
918100566 1:181369650-181369672 CCACACTGCCCTGGAGACACAGG + Intergenic
919789667 1:201283133-201283155 CCAGGCTGCCCAGGAGAGCCAGG - Intergenic
921255726 1:213337611-213337633 CCACAGTGACCATGAGATACTGG - Intergenic
922256174 1:223894711-223894733 CCAGGCTGCCCAGGAGAATGTGG + Intergenic
923085835 1:230703164-230703186 CCACGCGGCCCAGGAAGTGCAGG + Exonic
924055047 1:240116791-240116813 CCATGCTGCCCAGCAGCTTCTGG + Intronic
924279463 1:242421540-242421562 CAAGCCTGACCAGGAGATACGGG + Intronic
924337380 1:242997577-242997599 CCAGGCTGCCCAGGAGAATGTGG + Intergenic
1064222659 10:13455285-13455307 CCACGCTGCCAAGGAGAAGGTGG + Intronic
1064563974 10:16621250-16621272 CCACCCTGCACAGGACATCCTGG + Intronic
1067147448 10:43703573-43703595 CCAGGCTGCCCAGGAAGTACAGG - Intergenic
1067178763 10:43969616-43969638 CCACGCTGACCAGGTGAGCCAGG - Intergenic
1069708917 10:70476847-70476869 CCTCCCTGCCCAGCAGATGCTGG - Intergenic
1071811578 10:89187539-89187561 GCAGGCTGCCAAGCAGATACTGG + Intergenic
1072860128 10:98994844-98994866 CCACTCTGCCAAGGAGGGACAGG - Intronic
1074267387 10:111918167-111918189 CCACTGTGCCCAGTAGATAGAGG - Intergenic
1076623801 10:131809410-131809432 CCCCAGTGCCCAGGAGATCCAGG + Intergenic
1077646737 11:3932029-3932051 CCACACAGCCCAGGAGCAACAGG - Intronic
1077647869 11:3942321-3942343 CCACTCTGCCCAGGAAATGGAGG - Intronic
1079948359 11:26770597-26770619 CCACCATGCCCAGCTGATACTGG + Intergenic
1081905290 11:46665445-46665467 CCAGGCTGACCAGGAGAGACTGG + Exonic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084574190 11:69978024-69978046 CCAAGCTGCCCTGGGGACACCGG - Intergenic
1084705007 11:70811004-70811026 CCATGCAGCCCAGGGGACACTGG - Intronic
1085454963 11:76660458-76660480 CCACAATGCCCTGGAGACACTGG - Exonic
1085482170 11:76831668-76831690 CCACCATGCCCAGCTGATACTGG - Intergenic
1085531987 11:77197358-77197380 CCACGATGCACAGGAGGTGCAGG + Intronic
1089373106 11:117975569-117975591 CCACTCTTCCCAGGACACACTGG - Intergenic
1091851003 12:3696891-3696913 CCAGGCTGTCCAGGGGATGCAGG + Exonic
1092475298 12:8813790-8813812 CCAGCCTGCCCTGGAGATATTGG - Intergenic
1092947775 12:13472622-13472644 CCACTCTGCCCAGGAGATTTAGG - Intergenic
1094850021 12:34378183-34378205 ACACGCAGCCCAGGGGACACTGG - Intergenic
1095715515 12:45342133-45342155 CCACTATGCCCAGGAGTAACAGG + Intronic
1096597723 12:52707421-52707443 CCACTCTGCCCAGCAGTTGCAGG - Intergenic
1097015812 12:55986479-55986501 CCAGGATGCCAAGGAGATACTGG + Intronic
1106231721 13:27825931-27825953 ACACCCTGCCCAGGAGAGAAAGG + Intergenic
1106435473 13:29719993-29720015 CCCCAATGCCCAGGACATACAGG - Intergenic
1116425243 14:44782739-44782761 CCAGCCTGGCCAGCAGATACTGG + Intergenic
1117748024 14:58891367-58891389 GCAGGCTGCCCTGGAGAAACAGG - Intergenic
1122605778 14:102946764-102946786 CCACGCACCCCAGGAGCAACGGG + Intronic
1131286089 15:91058963-91058985 CCAACCTGCTGAGGAGATACTGG - Intergenic
1131574369 15:93571871-93571893 CCACTCAGCCCAGGAGATCCGGG - Intergenic
1131990407 15:98088274-98088296 CCACGGAGGCCAGAAGATACTGG + Intergenic
1132682655 16:1149543-1149565 CCACGCTGCCCAGGGGAAGGAGG - Intergenic
1132690214 16:1178731-1178753 CCAACCTGCCCAGGAGCTCCTGG - Intronic
1133185350 16:4092312-4092334 CAACACTGCCCAGGAGGAACTGG - Intronic
1133300733 16:4780971-4780993 CCACCGTGCCCAGCAGAGACAGG - Intronic
1133456639 16:5948036-5948058 CAACGCTGCTCAGGAGAGGCAGG + Intergenic
1133783876 16:8960525-8960547 CCACTCTGCCCAGGAGGTGCAGG + Intronic
1134846534 16:17445535-17445557 CCACGCAGCCCAGGTGAGCCCGG - Intronic
1136363853 16:29799404-29799426 CCACTTTGCCCAGGACAAACAGG - Exonic
1137005737 16:35273231-35273253 ACACGCTTCCTAGTAGATACTGG - Intergenic
1137720751 16:50625985-50626007 CCATGCTGCCCAGGAGCTTGGGG + Intronic
1138537732 16:57668642-57668664 CCACAGTGCCCTGGAGATAGGGG + Intronic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1143156682 17:4841812-4841834 CCACCGTGCCCAGCATATACTGG - Intronic
1145294272 17:21575530-21575552 CCAGGCCCCCCTGGAGATACTGG + Intergenic
1145369555 17:22297656-22297678 CCAGGCCCCCCTGGAGATACTGG - Intergenic
1145906697 17:28520337-28520359 CCACACGGCCCAGGAGAGAGGGG - Intronic
1149781193 17:59397823-59397845 CCACTCAGCCCAGGAGAACCAGG - Exonic
1152799180 17:82323140-82323162 CGCCGTTGCCCAGGAGGTACAGG + Intronic
1152862868 17:82705870-82705892 CACAGCTGCCCAGGAGATGCCGG - Intergenic
1154330587 18:13426061-13426083 CCACACTGCACAGGTGAAACCGG + Intronic
1158570132 18:58591127-58591149 CTCTGCTGCCCAGGAGATAGTGG + Intronic
1158631854 18:59122268-59122290 CCACTGTGCTCAGGAGACACTGG - Intergenic
1159021308 18:63145373-63145395 CCCCACTGCCCAAGAGATCCAGG + Intronic
1162347053 19:10125125-10125147 CCACTGTGCCCAGCAGAAACAGG - Intergenic
1162840219 19:13350792-13350814 CCACGCTGTCCTCGAGCTACTGG - Intronic
1163466700 19:17471985-17472007 TCAAGCTGCCCAGAACATACTGG + Intronic
1163863811 19:19756005-19756027 CCATGCTGACCAGGACACACTGG + Intergenic
1164208970 19:23081258-23081280 CCAAGCTGCTCAGGAGGTTCAGG - Intronic
1164754813 19:30681609-30681631 GCTCTCTGCCCAGCAGATACTGG + Intronic
1164809860 19:31147398-31147420 CCACGCTGGCCAGGGTATGCAGG - Intergenic
1165838707 19:38774186-38774208 CTCGGCTGCCCAGGAGATGCAGG + Intergenic
1166902011 19:46071823-46071845 CCATGTTGCCCAGGAGTTGCTGG - Intronic
1167953596 19:53046878-53046900 CCACCGTGCCCAGCCGATACGGG - Intronic
926143974 2:10385623-10385645 CCACGCGGCCAAGCAGACACCGG - Intronic
927831757 2:26357596-26357618 CCAGGCAGGCCAGGAGCTACTGG - Intronic
931867004 2:66424654-66424676 ACAGGCTGCCCAAGAGAGACAGG + Intergenic
932347238 2:71003734-71003756 ACATGCTGCCCAGGAAACACTGG - Intergenic
932347565 2:71005672-71005694 ACATGCTGCCCAGGAAATGCTGG - Intergenic
932743660 2:74313133-74313155 CCAAGCTACCCAGGAGACAGAGG - Intronic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
936258310 2:110935636-110935658 CCAGGTTGCTCAGGAGCTACTGG - Intronic
937262930 2:120597939-120597961 CCTGGCTGCCCTGGAGACACGGG + Intergenic
937966212 2:127513334-127513356 CCAGGCTGCACATGAGGTACGGG + Intronic
938605230 2:132885497-132885519 CCACGCTGAGCAGGAAATCCCGG - Intronic
938976138 2:136480498-136480520 CCACCCAGCCAAGGAGAAACAGG - Intergenic
943831001 2:192461941-192461963 CCATGTTGCTCAGGAAATACTGG - Intergenic
947166729 2:227269942-227269964 CCAGGGTCCCCAGGAAATACAGG + Exonic
948613743 2:239185229-239185251 CAACTCTTCCCAGGAGATACAGG - Intronic
948862313 2:240758560-240758582 CCACTGTCCCCAGGAGATAAGGG - Intronic
1170148782 20:13206090-13206112 CCATATTGCCCAGGTGATACGGG + Intergenic
1170529808 20:17279632-17279654 CCACTATGCCCAGTAGAGACAGG - Intronic
1171397118 20:24842593-24842615 CCTCGCTGCTCAGCAGAAACAGG - Intergenic
1176146272 20:63566834-63566856 CCACGGTGCCCAGGTGAGCCCGG - Exonic
1179355602 21:40655842-40655864 CCACGCTGGCCTGGAGCTCCTGG - Intronic
1180997354 22:19972094-19972116 CCACCCTGTCCTGGAGATCCAGG + Intronic
1181116818 22:20636607-20636629 CCACTCTGCCCAGGAGCCCCGGG - Intergenic
1182189928 22:28448727-28448749 CCACACAGCCCAGGTGATGCAGG + Intronic
1182648461 22:31829782-31829804 CCCTGCTGCCCAGCAGAGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
959461418 3:106630320-106630342 TCACGCTGGGCAGGAGATAGAGG + Intergenic
961454514 3:127017412-127017434 CCAGGCAGCCCTGGAGACACAGG - Exonic
962271235 3:133979418-133979440 CCACGCTGACCACAAGATCCAGG - Intronic
968577317 4:1373958-1373980 CCACGCTCCCCAGGAGCTACGGG - Intronic
968613180 4:1566279-1566301 CCACGGTGCCCAGGAGCACCAGG + Intergenic
968636932 4:1685384-1685406 CCACGGTGGCCAGGGGACACAGG - Intergenic
968921601 4:3524997-3525019 CCACGCTGATCTGAAGATACAGG - Exonic
969844696 4:9911234-9911256 TCCCGCTGCCCAGGGGCTACAGG + Intronic
970844706 4:20522828-20522850 CCAGACTGCCCAGCACATACTGG - Intronic
970899801 4:21145574-21145596 CCACAGTGCCCAGGAAATATTGG - Intronic
973274184 4:48291571-48291593 CCACCCTGCCCAGCAGAGGCAGG + Intergenic
979239753 4:118437731-118437753 CCAGGCTGCCCAGGAGAATGTGG - Intergenic
981487379 4:145301543-145301565 CCACACTGCCCAGAAGCTGCTGG - Intergenic
985891168 5:2716068-2716090 CCACCCTGCCCAGGAGGCCCAGG + Intergenic
986061869 5:4199269-4199291 GCACGCTGCCCAGCAGACCCAGG - Intergenic
987312520 5:16694469-16694491 CCACGCTGTCCAGGAGAAATTGG - Exonic
987576571 5:19735680-19735702 CCACTGTGCCCAGCCGATACTGG + Intronic
988826754 5:34943972-34943994 CCAAGCTGCCCTGGAGATAATGG - Intronic
990211939 5:53490223-53490245 GAATTCTGCCCAGGAGATACTGG - Intergenic
991227067 5:64285678-64285700 CCACACAGGCCAGGAGATAGAGG + Intronic
997295155 5:132764410-132764432 CCTCACTGCCCAGGGGAGACCGG - Exonic
998795021 5:145809387-145809409 CCACTCTGCCCAGGAGAGGGTGG + Intronic
1000336885 5:160248025-160248047 CCACGTTGCCCAGCAGAGATAGG + Intergenic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1002740002 5:181428313-181428335 CCAGGCTGCCCAGGAGAATGTGG - Intergenic
1005570524 6:27141014-27141036 CCACTTTCCCCAGGAGCTACAGG + Intergenic
1007484999 6:42174874-42174896 CCTCGCTGCCCAGAAGGTCCAGG + Intronic
1009735947 6:67675680-67675702 CCACGCTGCCAAAGTGATGCAGG + Intergenic
1010369846 6:75095151-75095173 CCAGGCTCCCCAGGAGTCACAGG - Exonic
1015767808 6:136737580-136737602 TCACGCTGCCCAGGAGGCTCCGG + Intronic
1018455952 6:163952276-163952298 CCACACTGACCAGGAGATCCAGG + Intergenic
1019245114 6:170703913-170703935 CCAGGCTGCCCAGGAGAATGTGG - Intergenic
1024216521 7:47253729-47253751 CCACACTGCCCCGGAGACACAGG - Intergenic
1024797453 7:53036160-53036182 CCCCGCCGCCCAGGAGCTCCTGG + Exonic
1032557325 7:132850270-132850292 CCAAGCCACCCAGGAGATAATGG - Intronic
1033498011 7:141919067-141919089 CCTCTCTGCCCTGGAGATCCTGG + Exonic
1034274782 7:149819351-149819373 CCACGGGGCCCAGGAGGTCCAGG - Intergenic
1038318533 8:26508267-26508289 CCCTGCTACCCATGAGATACCGG - Exonic
1039912296 8:41834933-41834955 CCCCGCTGCCCGGGAGAAGCTGG + Intronic
1044834631 8:96283724-96283746 CCCAGCTGCCCAGGAGCTCCAGG - Intronic
1047747474 8:127855611-127855633 ACACACTCCCCAGGAGAGACTGG + Intergenic
1060758949 9:126232856-126232878 CCACTCTTCCCAGGGGATAGTGG - Intergenic
1061957939 9:133973282-133973304 CCACTCTGCACAGGAAAAACTGG + Intronic
1203605309 Un_KI270748v1:53121-53143 CCAGGCTGCCCAGGAGAATGTGG - Intergenic
1186836456 X:13443250-13443272 CCATGCTGCCATGGAGATCCTGG + Intergenic
1190064327 X:47229784-47229806 TCACCCTCCCCAGGAGATAGGGG - Exonic
1190104709 X:47551320-47551342 CCCAGCTGCTCAGGAGACACAGG + Intergenic
1195592742 X:106650164-106650186 ACCCATTGCCCAGGAGATACAGG - Intronic
1201189231 Y:11432219-11432241 CCAGGCTGCTCCGGAAATACTGG + Intergenic
1202387494 Y:24339561-24339583 CCAGGCTGCCCAGGAGAATGTGG - Intergenic
1202483292 Y:25330567-25330589 CCAGGCTGCCCAGGAGAATGTGG + Intergenic