ID: 1002455901

View in Genome Browser
Species Human (GRCh38)
Location 5:179345222-179345244
Sequence TTCGCGGGCGGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3196
Summary {0: 2, 1: 3, 2: 53, 3: 352, 4: 2786}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002455887_1002455901 19 Left 1002455887 5:179345180-179345202 CCGCACCTACCTGGGGGGTCGGC 0: 1
1: 0
2: 0
3: 6
4: 226
Right 1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG 0: 2
1: 3
2: 53
3: 352
4: 2786
1002455892_1002455901 10 Left 1002455892 5:179345189-179345211 CCTGGGGGGTCGGCGGCGGCGGC 0: 1
1: 7
2: 29
3: 276
4: 784
Right 1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG 0: 2
1: 3
2: 53
3: 352
4: 2786
1002455889_1002455901 14 Left 1002455889 5:179345185-179345207 CCTACCTGGGGGGTCGGCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG 0: 2
1: 3
2: 53
3: 352
4: 2786
1002455884_1002455901 24 Left 1002455884 5:179345175-179345197 CCGGGCCGCACCTACCTGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG 0: 2
1: 3
2: 53
3: 352
4: 2786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002455901 Original CRISPR TTCGCGGGCGGCGGCGGCGG CGG Exonic
Too many off-targets to display for this crispr