ID: 1002461711

View in Genome Browser
Species Human (GRCh38)
Location 5:179377109-179377131
Sequence CTCACTCCTGTCTCAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002461702_1002461711 30 Left 1002461702 5:179377056-179377078 CCCCAGGCACCATCTAGATCCAC No data
Right 1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG No data
1002461705_1002461711 21 Left 1002461705 5:179377065-179377087 CCATCTAGATCCACAAGCAGTGA No data
Right 1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG No data
1002461704_1002461711 28 Left 1002461704 5:179377058-179377080 CCAGGCACCATCTAGATCCACAA No data
Right 1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG No data
1002461703_1002461711 29 Left 1002461703 5:179377057-179377079 CCCAGGCACCATCTAGATCCACA No data
Right 1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG No data
1002461708_1002461711 11 Left 1002461708 5:179377075-179377097 CCACAAGCAGTGAGGCAGGTTTT No data
Right 1002461711 5:179377109-179377131 CTCACTCCTGTCTCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002461711 Original CRISPR CTCACTCCTGTCTCAGGACC AGG Intergenic
No off target data available for this crispr