ID: 1002462312

View in Genome Browser
Species Human (GRCh38)
Location 5:179380517-179380539
Sequence TCACCTGCAGATGCCGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462312_1002462318 16 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462318 5:179380556-179380578 ACCTTCGAGGAACCATGGAGCGG No data
1002462312_1002462321 30 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462312_1002462317 11 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462317 5:179380551-179380573 AGGAAACCTTCGAGGAACCATGG No data
1002462312_1002462314 -9 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462314 5:179380531-179380553 TGCAGGTGAAAAACTCCAGCAGG No data
1002462312_1002462315 3 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462315 5:179380543-179380565 ACTCCAGCAGGAAACCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462312 Original CRISPR TCACCTGCAGATGCCGTGAT GGG (reversed) Intergenic
No off target data available for this crispr