ID: 1002462313

View in Genome Browser
Species Human (GRCh38)
Location 5:179380518-179380540
Sequence TTCACCTGCAGATGCCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462313_1002462321 29 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462313_1002462317 10 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462317 5:179380551-179380573 AGGAAACCTTCGAGGAACCATGG No data
1002462313_1002462314 -10 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462314 5:179380531-179380553 TGCAGGTGAAAAACTCCAGCAGG No data
1002462313_1002462318 15 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462318 5:179380556-179380578 ACCTTCGAGGAACCATGGAGCGG No data
1002462313_1002462315 2 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462315 5:179380543-179380565 ACTCCAGCAGGAAACCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462313 Original CRISPR TTCACCTGCAGATGCCGTGA TGG (reversed) Intergenic
No off target data available for this crispr