ID: 1002462316

View in Genome Browser
Species Human (GRCh38)
Location 5:179380546-179380568
Sequence GTTCCTCGAAGGTTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462316_1002462325 22 Left 1002462316 5:179380546-179380568 CCAGCAGGAAACCTTCGAGGAAC No data
Right 1002462325 5:179380591-179380613 GGCAGCTTCCCATACCCGCCAGG No data
1002462316_1002462327 30 Left 1002462316 5:179380546-179380568 CCAGCAGGAAACCTTCGAGGAAC No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462316_1002462321 1 Left 1002462316 5:179380546-179380568 CCAGCAGGAAACCTTCGAGGAAC No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462316 Original CRISPR GTTCCTCGAAGGTTTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr