ID: 1002462319

View in Genome Browser
Species Human (GRCh38)
Location 5:179380557-179380579
Sequence GCCGCTCCATGGTTCCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462319_1002462325 11 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462325 5:179380591-179380613 GGCAGCTTCCCATACCCGCCAGG No data
1002462319_1002462327 19 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG No data
1002462319_1002462321 -10 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462319_1002462331 26 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462331 5:179380606-179380628 CCGCCAGGCCGACAGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462319 Original CRISPR GCCGCTCCATGGTTCCTCGA AGG (reversed) Intergenic
No off target data available for this crispr