ID: 1002462321

View in Genome Browser
Species Human (GRCh38)
Location 5:179380570-179380592
Sequence ATGGAGCGGCCCCTTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002462319_1002462321 -10 Left 1002462319 5:179380557-179380579 CCTTCGAGGAACCATGGAGCGGC No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462313_1002462321 29 Left 1002462313 5:179380518-179380540 CCATCACGGCATCTGCAGGTGAA No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462312_1002462321 30 Left 1002462312 5:179380517-179380539 CCCATCACGGCATCTGCAGGTGA No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data
1002462316_1002462321 1 Left 1002462316 5:179380546-179380568 CCAGCAGGAAACCTTCGAGGAAC No data
Right 1002462321 5:179380570-179380592 ATGGAGCGGCCCCTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002462321 Original CRISPR ATGGAGCGGCCCCTTGAGAG AGG Intergenic
No off target data available for this crispr